Incidental Mutation 'R6137:Tuba4a'
ID488379
Institutional Source Beutler Lab
Gene Symbol Tuba4a
Ensembl Gene ENSMUSG00000026202
Gene Nametubulin, alpha 4A
SynonymsTuba4, M[a]4
MMRRC Submission 044284-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.361) question?
Stock #R6137 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location75214228-75219865 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 75216055 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 305 (C305F)
Ref Sequence ENSEMBL: ENSMUSP00000140657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027401] [ENSMUST00000123825] [ENSMUST00000144355] [ENSMUST00000179573] [ENSMUST00000180101] [ENSMUST00000186213] [ENSMUST00000186758] [ENSMUST00000189698] [ENSMUST00000190717] [ENSMUST00000188460] [ENSMUST00000191108] [ENSMUST00000188593] [ENSMUST00000189131]
Predicted Effect probably benign
Transcript: ENSMUST00000027401
SMART Domains Protein: ENSMUSP00000027401
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 290 3.3e-47 PFAM
Pfam:Pkinase_Tyr 21 290 3e-28 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000079464
AA Change: C333F
SMART Domains Protein: ENSMUSP00000078429
Gene: ENSMUSG00000026202
AA Change: C333F

DomainStartEndE-ValueType
Tubulin 49 246 4.34e-79 SMART
Tubulin_C 248 393 7.88e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123825
SMART Domains Protein: ENSMUSP00000122688
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 122 9.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126328
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142052
Predicted Effect probably benign
Transcript: ENSMUST00000144355
SMART Domains Protein: ENSMUSP00000115964
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 122 9.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156012
Predicted Effect probably benign
Transcript: ENSMUST00000179573
Predicted Effect probably benign
Transcript: ENSMUST00000180101
Predicted Effect probably damaging
Transcript: ENSMUST00000186213
AA Change: C305F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140657
Gene: ENSMUSG00000026202
AA Change: C305F

DomainStartEndE-ValueType
Tubulin 49 246 4.34e-79 SMART
Tubulin_C 248 393 7.88e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186492
Predicted Effect probably benign
Transcript: ENSMUST00000186758
SMART Domains Protein: ENSMUSP00000140552
Gene: ENSMUSG00000026202

DomainStartEndE-ValueType
Pfam:Tubulin 1 100 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187103
Predicted Effect probably benign
Transcript: ENSMUST00000189698
SMART Domains Protein: ENSMUSP00000140329
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
S_TKc 20 203 1.1e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190717
SMART Domains Protein: ENSMUSP00000141097
Gene: ENSMUSG00000026202

DomainStartEndE-ValueType
Pfam:Tubulin 1 89 1.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188460
SMART Domains Protein: ENSMUSP00000139998
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
S_TKc 20 172 1e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191108
SMART Domains Protein: ENSMUSP00000139846
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 186 8.6e-29 PFAM
Pfam:Pkinase_Tyr 21 184 2.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188593
SMART Domains Protein: ENSMUSP00000140881
Gene: ENSMUSG00000026202

DomainStartEndE-ValueType
Pfam:Tubulin 2 75 2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189131
SMART Domains Protein: ENSMUSP00000140970
Gene: ENSMUSG00000026202

DomainStartEndE-ValueType
Pfam:Tubulin 1 81 3.6e-15 PFAM
Meta Mutation Damage Score 0.9551 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulin. The genes encoding these microtubule constituents are part of the tubulin superfamily, which is composed of six distinct families. Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly. There are multiple alpha and beta tubulin genes and they are highly conserved among and between species. This gene encodes an alpha tubulin that is a highly conserved homolog of a rat testis-specific alpha tubulin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A T 19: 8,740,784 D6V probably damaging Het
2310057M21Rik G T 7: 131,357,613 H165Q probably damaging Het
Akap13 T A 7: 75,677,416 F721Y probably damaging Het
Akap6 A T 12: 53,140,354 D1517V probably damaging Het
Amigo3 T A 9: 108,053,728 S117T probably damaging Het
Atf7ip2 T A 16: 10,201,411 N34K probably damaging Het
Cacnb1 A C 11: 98,005,782 V351G probably damaging Het
Casp9 T A 4: 141,805,349 probably null Het
Ccdc51 C T 9: 109,089,415 T24I probably benign Het
Cdh23 T A 10: 60,434,512 Y618F probably damaging Het
Chd1 T A 17: 15,758,688 W1271R probably damaging Het
Dars T C 1: 128,368,439 T386A probably benign Het
Dchs1 T A 7: 105,765,106 D834V probably damaging Het
Dgkd T A 1: 87,936,381 V933E possibly damaging Het
Dnah17 A G 11: 118,025,654 F4203S probably damaging Het
Fancm T C 12: 65,130,382 L2000P probably damaging Het
Fbxo11 A T 17: 88,008,669 H444Q probably benign Het
Fbxw14 T A 9: 109,276,222 T292S probably damaging Het
Fer1l6 T C 15: 58,559,206 S237P probably damaging Het
Frem3 T C 8: 80,615,047 I1323T probably benign Het
Grin2a A G 16: 9,653,449 F652L probably benign Het
Grin2b T A 6: 135,923,458 M142L possibly damaging Het
Helz A G 11: 107,619,060 Q503R possibly damaging Het
Ighv5-17 A G 12: 113,859,295 Y69H probably benign Het
Il17ra A G 6: 120,475,582 N242S probably benign Het
Immp1l G C 2: 105,964,208 G117A probably damaging Het
Itm2c T C 1: 85,894,692 V10A probably benign Het
Kif1b T C 4: 149,238,426 K679E possibly damaging Het
Kng1 T C 16: 23,074,645 V256A possibly damaging Het
Lamc2 T G 1: 153,166,153 R78S possibly damaging Het
Loxl4 A G 19: 42,598,793 F621S probably damaging Het
Lpl T A 8: 68,892,747 D134E probably damaging Het
Lypd3 T C 7: 24,640,494 Y329H probably benign Het
Mettl13 T C 1: 162,535,886 D225G probably benign Het
Myo7b A G 18: 31,999,974 F441L probably damaging Het
Nnt T A 13: 119,336,328 M699L possibly damaging Het
Nr1h3 A T 2: 91,191,851 M144K probably damaging Het
Olfr1040 A G 2: 86,145,969 V255A probably benign Het
Olfr1347 T C 7: 6,488,845 T3A probably benign Het
Olfr325 A T 11: 58,581,068 M75L probably benign Het
Pappa2 A T 1: 158,871,543 Y667N probably damaging Het
Prps1l3 A G 12: 57,238,888 I155V probably benign Het
Ptgs2 T A 1: 150,100,993 N24K probably benign Het
Ralgds A T 2: 28,547,588 M514L probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Sacm1l T A 9: 123,569,005 V254D probably damaging Het
Selenot A T 3: 58,585,284 Q64L probably damaging Het
Sgsm2 G A 11: 74,850,851 R1037W probably damaging Het
Slc22a12 A G 19: 6,542,724 V10A probably benign Het
Spem2 G T 11: 69,816,696 S481* probably null Het
Styk1 C T 6: 131,311,016 G128D probably damaging Het
Tmc6 A T 11: 117,776,328 L148Q probably damaging Het
Tmem138 A C 19: 10,574,835 probably null Het
Tnpo3 A G 6: 29,555,268 V772A probably benign Het
Topaz1 T C 9: 122,797,756 F1483S possibly damaging Het
Ubap1 T G 4: 41,379,262 F159V possibly damaging Het
Vmn2r9 A G 5: 108,849,016 I129T probably benign Het
Wwc2 A T 8: 47,856,263 M828K unknown Het
Zfp236 A T 18: 82,671,794 S187T possibly damaging Het
Other mutations in Tuba4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Tuba4a APN 1 75217277 missense probably damaging 1.00
andropov UTSW 1 75217394 missense probably damaging 1.00
R0453:Tuba4a UTSW 1 75215858 missense probably damaging 1.00
R0573:Tuba4a UTSW 1 75216373 missense probably benign 0.01
R1488:Tuba4a UTSW 1 75216401 missense probably benign 0.08
R1660:Tuba4a UTSW 1 75215903 missense probably benign 0.35
R1836:Tuba4a UTSW 1 75216110 missense probably benign 0.20
R2012:Tuba4a UTSW 1 75216339 nonsense probably null
R2437:Tuba4a UTSW 1 75217425 missense possibly damaging 0.47
R4180:Tuba4a UTSW 1 75215782 missense probably benign 0.33
R5505:Tuba4a UTSW 1 75216416 missense probably damaging 1.00
R6189:Tuba4a UTSW 1 75216874 missense probably benign 0.34
R6566:Tuba4a UTSW 1 75217286 missense probably damaging 1.00
R6837:Tuba4a UTSW 1 75217394 missense probably damaging 1.00
R6883:Tuba4a UTSW 1 75217422 missense probably damaging 1.00
R7213:Tuba4a UTSW 1 75215697 missense possibly damaging 0.86
R7765:Tuba4a UTSW 1 75216359 missense probably benign 0.25
R8071:Tuba4a UTSW 1 75216951 missense
R8326:Tuba4a UTSW 1 75218621 missense
R8334:Tuba4a UTSW 1 75217301 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTGTGTTGCTCAGCATGCAC -3'
(R):5'- AATGTGGACCTGACAGAGTTCC -3'

Sequencing Primer
(F):5'- TTGCTCAGCATGCACACAGC -3'
(R):5'- GGACCTGACAGAGTTCCAGACC -3'
Posted On2017-10-10