Incidental Mutation 'R6137:Dgkd'
ID488381
Institutional Source Beutler Lab
Gene Symbol Dgkd
Ensembl Gene ENSMUSG00000070738
Gene Namediacylglycerol kinase, delta
Synonymsdgkd-2, DGKdelta, AI841987, D330025K09
MMRRC Submission 044284-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.743) question?
Stock #R6137 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location87853287-87945180 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87936381 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 933 (V933E)
Ref Sequence ENSEMBL: ENSMUSP00000027517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027517] [ENSMUST00000189448] [ENSMUST00000190061]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027517
AA Change: V933E

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027517
Gene: ENSMUSG00000070738
AA Change: V933E

DomainStartEndE-ValueType
low complexity region 2 36 N/A INTRINSIC
PH 54 148 1.7e-16 SMART
C1 164 213 2.48e-15 SMART
low complexity region 221 232 N/A INTRINSIC
C1 236 286 8.56e-10 SMART
DAGKc 321 446 9.44e-62 SMART
low complexity region 691 710 N/A INTRINSIC
DAGKa 765 922 1.25e-98 SMART
low complexity region 1128 1139 N/A INTRINSIC
SAM 1148 1214 2.16e-22 SMART
Predicted Effect unknown
Transcript: ENSMUST00000185260
AA Change: V121E
Predicted Effect probably benign
Transcript: ENSMUST00000189448
SMART Domains Protein: ENSMUSP00000139626
Gene: ENSMUSG00000070738

DomainStartEndE-ValueType
low complexity region 82 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189726
Predicted Effect probably benign
Transcript: ENSMUST00000190061
AA Change: V106E

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139658
Gene: ENSMUSG00000070738
AA Change: V106E

DomainStartEndE-ValueType
DAGKa 1 95 7.6e-26 SMART
Blast:DAGKa 119 188 1e-23 BLAST
low complexity region 301 312 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic enzyme that phosphorylates diacylglycerol to produce phosphatidic acid. Diacylglycerol and phosphatidic acid are two lipids that act as second messengers in signaling cascades. Their cellular concentrations are regulated by the encoded protein, and so it is thought to play an important role in cellular signal transduction. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are born with open eyelids and reduced body size, develop respiratory distress and die within 24 hrs of birth. Half of mice homozygous for a hypomorphic gene trap allele exhibit abnormal epileptic discharges and seizureswhile 9% of aging homozygotes develop tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A T 19: 8,740,784 D6V probably damaging Het
2310057M21Rik G T 7: 131,357,613 H165Q probably damaging Het
Akap13 T A 7: 75,677,416 F721Y probably damaging Het
Akap6 A T 12: 53,140,354 D1517V probably damaging Het
Amigo3 T A 9: 108,053,728 S117T probably damaging Het
Atf7ip2 T A 16: 10,201,411 N34K probably damaging Het
Cacnb1 A C 11: 98,005,782 V351G probably damaging Het
Casp9 T A 4: 141,805,349 probably null Het
Ccdc51 C T 9: 109,089,415 T24I probably benign Het
Cdh23 T A 10: 60,434,512 Y618F probably damaging Het
Chd1 T A 17: 15,758,688 W1271R probably damaging Het
Dars T C 1: 128,368,439 T386A probably benign Het
Dchs1 T A 7: 105,765,106 D834V probably damaging Het
Dnah17 A G 11: 118,025,654 F4203S probably damaging Het
Fancm T C 12: 65,130,382 L2000P probably damaging Het
Fbxo11 A T 17: 88,008,669 H444Q probably benign Het
Fbxw14 T A 9: 109,276,222 T292S probably damaging Het
Fer1l6 T C 15: 58,559,206 S237P probably damaging Het
Frem3 T C 8: 80,615,047 I1323T probably benign Het
Grin2a A G 16: 9,653,449 F652L probably benign Het
Grin2b T A 6: 135,923,458 M142L possibly damaging Het
Helz A G 11: 107,619,060 Q503R possibly damaging Het
Ighv5-17 A G 12: 113,859,295 Y69H probably benign Het
Il17ra A G 6: 120,475,582 N242S probably benign Het
Immp1l G C 2: 105,964,208 G117A probably damaging Het
Itm2c T C 1: 85,894,692 V10A probably benign Het
Kif1b T C 4: 149,238,426 K679E possibly damaging Het
Kng1 T C 16: 23,074,645 V256A possibly damaging Het
Lamc2 T G 1: 153,166,153 R78S possibly damaging Het
Loxl4 A G 19: 42,598,793 F621S probably damaging Het
Lpl T A 8: 68,892,747 D134E probably damaging Het
Lypd3 T C 7: 24,640,494 Y329H probably benign Het
Mettl13 T C 1: 162,535,886 D225G probably benign Het
Myo7b A G 18: 31,999,974 F441L probably damaging Het
Nnt T A 13: 119,336,328 M699L possibly damaging Het
Nr1h3 A T 2: 91,191,851 M144K probably damaging Het
Olfr1040 A G 2: 86,145,969 V255A probably benign Het
Olfr1347 T C 7: 6,488,845 T3A probably benign Het
Olfr325 A T 11: 58,581,068 M75L probably benign Het
Pappa2 A T 1: 158,871,543 Y667N probably damaging Het
Prps1l3 A G 12: 57,238,888 I155V probably benign Het
Ptgs2 T A 1: 150,100,993 N24K probably benign Het
Ralgds A T 2: 28,547,588 M514L probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Sacm1l T A 9: 123,569,005 V254D probably damaging Het
Selenot A T 3: 58,585,284 Q64L probably damaging Het
Sgsm2 G A 11: 74,850,851 R1037W probably damaging Het
Slc22a12 A G 19: 6,542,724 V10A probably benign Het
Spem2 G T 11: 69,816,696 S481* probably null Het
Styk1 C T 6: 131,311,016 G128D probably damaging Het
Tmc6 A T 11: 117,776,328 L148Q probably damaging Het
Tmem138 A C 19: 10,574,835 probably null Het
Tnpo3 A G 6: 29,555,268 V772A probably benign Het
Topaz1 T C 9: 122,797,756 F1483S possibly damaging Het
Tuba4a C A 1: 75,216,055 C305F probably damaging Het
Ubap1 T G 4: 41,379,262 F159V possibly damaging Het
Vmn2r9 A G 5: 108,849,016 I129T probably benign Het
Wwc2 A T 8: 47,856,263 M828K unknown Het
Zfp236 A T 18: 82,671,794 S187T possibly damaging Het
Other mutations in Dgkd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Dgkd APN 1 87880411 missense probably damaging 1.00
IGL01531:Dgkd APN 1 87880411 missense probably damaging 1.00
IGL01627:Dgkd APN 1 87880428 missense probably damaging 1.00
IGL01720:Dgkd APN 1 87936765 missense probably damaging 1.00
IGL01915:Dgkd APN 1 87926058 missense possibly damaging 0.86
IGL01941:Dgkd APN 1 87924559 missense probably damaging 0.99
IGL01951:Dgkd APN 1 87916916 missense probably damaging 1.00
IGL02244:Dgkd APN 1 87915141 missense probably benign 0.27
IGL02581:Dgkd APN 1 87918002 splice site probably benign
IGL02852:Dgkd APN 1 87935413 missense probably damaging 1.00
IGL02893:Dgkd APN 1 87915208 splice site probably benign
IGL03367:Dgkd APN 1 87940308 critical splice donor site probably null
R0014:Dgkd UTSW 1 87881881 missense probably damaging 1.00
R0016:Dgkd UTSW 1 87917952 missense probably benign 0.02
R0219:Dgkd UTSW 1 87938274 splice site probably benign
R0496:Dgkd UTSW 1 87936900 missense probably null 0.83
R0559:Dgkd UTSW 1 87915104 missense probably damaging 1.00
R0591:Dgkd UTSW 1 87915104 missense probably damaging 1.00
R1270:Dgkd UTSW 1 87934125 missense probably damaging 0.96
R1599:Dgkd UTSW 1 87881886 missense possibly damaging 0.58
R1658:Dgkd UTSW 1 87926268 missense probably damaging 1.00
R1745:Dgkd UTSW 1 87932044 critical splice donor site probably null
R1959:Dgkd UTSW 1 87929827 missense possibly damaging 0.47
R1960:Dgkd UTSW 1 87929827 missense possibly damaging 0.47
R2044:Dgkd UTSW 1 87927691 missense probably benign
R2148:Dgkd UTSW 1 87881921 missense probably damaging 1.00
R2232:Dgkd UTSW 1 87929742 missense probably benign 0.05
R2266:Dgkd UTSW 1 87927818 unclassified probably benign
R3774:Dgkd UTSW 1 87936300 missense probably damaging 1.00
R4004:Dgkd UTSW 1 87935423 missense possibly damaging 0.56
R4005:Dgkd UTSW 1 87935423 missense possibly damaging 0.56
R4133:Dgkd UTSW 1 87941501 critical splice donor site probably null
R4235:Dgkd UTSW 1 87931982 nonsense probably null
R4644:Dgkd UTSW 1 87936294 missense probably damaging 1.00
R4747:Dgkd UTSW 1 87934167 missense probably damaging 1.00
R4864:Dgkd UTSW 1 87916838 missense possibly damaging 0.94
R5334:Dgkd UTSW 1 87938267 critical splice donor site probably null
R5365:Dgkd UTSW 1 87935416 missense probably damaging 1.00
R5495:Dgkd UTSW 1 87926872 missense probably damaging 1.00
R5514:Dgkd UTSW 1 87934110 missense probably damaging 1.00
R5729:Dgkd UTSW 1 87936332 nonsense probably null
R5766:Dgkd UTSW 1 87880449 nonsense probably null
R6133:Dgkd UTSW 1 87938240 missense possibly damaging 0.93
R6198:Dgkd UTSW 1 87924208 missense probably damaging 1.00
R6297:Dgkd UTSW 1 87926144 missense possibly damaging 0.94
R6577:Dgkd UTSW 1 87940240 missense probably damaging 1.00
R6846:Dgkd UTSW 1 87925691 splice site probably null
R6905:Dgkd UTSW 1 87935375 missense probably damaging 1.00
R7369:Dgkd UTSW 1 87921622 missense probably damaging 1.00
R7763:Dgkd UTSW 1 87926949 missense probably benign
Z1176:Dgkd UTSW 1 87927810 missense probably benign 0.05
Z1177:Dgkd UTSW 1 87916886 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACCCCTTTAGCCTGATATCCG -3'
(R):5'- AGGGCACACCACTATGTCAG -3'

Sequencing Primer
(F):5'- GATATCCGTATCTGTACCCAAGATC -3'
(R):5'- CAGCTAATCTCTGTATGGTGAAGAG -3'
Posted On2017-10-10