Incidental Mutation 'R6137:Ptgs2'
ID488383
Institutional Source Beutler Lab
Gene Symbol Ptgs2
Ensembl Gene ENSMUSG00000032487
Gene Nameprostaglandin-endoperoxide synthase 2
SynonymsCox-2, PHS-2, COX2, prostaglandin G/H synthase, PGHS-2, Pghs2, Tis10, cyclooxygenase 2, cyclooxygenase-2
MMRRC Submission 044284-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.697) question?
Stock #R6137 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location150100031-150108227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 150100993 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 24 (N24K)
Ref Sequence ENSEMBL: ENSMUSP00000035065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035065] [ENSMUST00000190784]
PDB Structure CRYSTAL STRUCTURE OF ARACHIDONIC ACID BOUND TO THE CYCLOOXYGENASE ACTIVE SITE OF COX-2 [X-RAY DIFFRACTION]
CYCLOOXYGENASE-2 (PROSTAGLANDIN SYNTHASE-2) COMPLEXED WITH A SELECTIVE INHIBITOR, SC-558 [X-RAY DIFFRACTION]
[]
[]
CRYSTAL STRUCTURE OF A MIXTURE OF ARACHIDONIC ACID AND PROSTAGLANDIN BOUND TO THE CYCLOOXYGENASE ACTIVE SITE OF COX-2: PROSTAGLANDIN STRUCTURE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF DICLOFENAC BOUND TO THE CYCLOOXYGENASE ACTIVE SITE OF COX-2 [X-RAY DIFFRACTION]
X-ray crystal structure of arachidonic acid bound to the cyclooxygenase channel of cyclooxygenase-2 [X-RAY DIFFRACTION]
X-ray crystal structure of eicosapentaenoic acid bound to the cyclooxygenase channel of cyclooxygenase-2 [X-RAY DIFFRACTION]
X-ray crystal structure of docosahexaenoic acid bound to the cyclooxygenase channel of cyclooxygenase-2 [X-RAY DIFFRACTION]
X-ray crystal structure of arachidonic acid bound in the cyclooxygenase channel of L531F murine COX-2 [X-RAY DIFFRACTION]
>> 25 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000035065
AA Change: N24K

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000035065
Gene: ENSMUSG00000032487
AA Change: N24K

DomainStartEndE-ValueType
EGF 20 55 2.64e1 SMART
low complexity region 182 198 N/A INTRINSIC
Pfam:An_peroxidase 206 562 7.3e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181915
Predicted Effect probably benign
Transcript: ENSMUST00000190784
SMART Domains Protein: ENSMUSP00000139904
Gene: ENSMUSG00000032487

DomainStartEndE-ValueType
Blast:EGF 1 23 2e-9 BLAST
SCOP:d1eqga2 1 26 5e-8 SMART
PDB:1CVU|B 1 62 1e-38 PDB
SCOP:d1cvua1 27 62 1e-20 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: This gene encodes an enzyme that is a member of the prostaglandin G/H synthase family. The encoded protein converts arachidonic acid to prostaglandin endoperoxide H2 which is a key enzymatic step in prostaglandin biosynthesis. This gene is the inducible prostaglandin G/H synthase family member that is upregulated during inflammation. Aberrant regulation of this gene is associated with cancer progression in several tissues and an increased risk of cardiovascular events. This gene is the target of many non-steroidal anti-inflammatory drugs. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice exhibit increased perinatal mortality associated with frequent lack of closure and remodeling of the ductus arteriosus, background-sensitive kidney dysplasia with microcyst formation, and myocardial fibrosis. Mutant females show impaired fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A T 19: 8,740,784 D6V probably damaging Het
2310057M21Rik G T 7: 131,357,613 H165Q probably damaging Het
Akap13 T A 7: 75,677,416 F721Y probably damaging Het
Akap6 A T 12: 53,140,354 D1517V probably damaging Het
Amigo3 T A 9: 108,053,728 S117T probably damaging Het
Atf7ip2 T A 16: 10,201,411 N34K probably damaging Het
Cacnb1 A C 11: 98,005,782 V351G probably damaging Het
Casp9 T A 4: 141,805,349 probably null Het
Ccdc51 C T 9: 109,089,415 T24I probably benign Het
Cdh23 T A 10: 60,434,512 Y618F probably damaging Het
Chd1 T A 17: 15,758,688 W1271R probably damaging Het
Dars T C 1: 128,368,439 T386A probably benign Het
Dchs1 T A 7: 105,765,106 D834V probably damaging Het
Dgkd T A 1: 87,936,381 V933E possibly damaging Het
Dnah17 A G 11: 118,025,654 F4203S probably damaging Het
Fancm T C 12: 65,130,382 L2000P probably damaging Het
Fbxo11 A T 17: 88,008,669 H444Q probably benign Het
Fbxw14 T A 9: 109,276,222 T292S probably damaging Het
Fer1l6 T C 15: 58,559,206 S237P probably damaging Het
Frem3 T C 8: 80,615,047 I1323T probably benign Het
Grin2a A G 16: 9,653,449 F652L probably benign Het
Grin2b T A 6: 135,923,458 M142L possibly damaging Het
Helz A G 11: 107,619,060 Q503R possibly damaging Het
Ighv5-17 A G 12: 113,859,295 Y69H probably benign Het
Il17ra A G 6: 120,475,582 N242S probably benign Het
Immp1l G C 2: 105,964,208 G117A probably damaging Het
Itm2c T C 1: 85,894,692 V10A probably benign Het
Kif1b T C 4: 149,238,426 K679E possibly damaging Het
Kng1 T C 16: 23,074,645 V256A possibly damaging Het
Lamc2 T G 1: 153,166,153 R78S possibly damaging Het
Loxl4 A G 19: 42,598,793 F621S probably damaging Het
Lpl T A 8: 68,892,747 D134E probably damaging Het
Lypd3 T C 7: 24,640,494 Y329H probably benign Het
Mettl13 T C 1: 162,535,886 D225G probably benign Het
Myo7b A G 18: 31,999,974 F441L probably damaging Het
Nnt T A 13: 119,336,328 M699L possibly damaging Het
Nr1h3 A T 2: 91,191,851 M144K probably damaging Het
Olfr1040 A G 2: 86,145,969 V255A probably benign Het
Olfr1347 T C 7: 6,488,845 T3A probably benign Het
Olfr325 A T 11: 58,581,068 M75L probably benign Het
Pappa2 A T 1: 158,871,543 Y667N probably damaging Het
Prps1l3 A G 12: 57,238,888 I155V probably benign Het
Ralgds A T 2: 28,547,588 M514L probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Sacm1l T A 9: 123,569,005 V254D probably damaging Het
Selenot A T 3: 58,585,284 Q64L probably damaging Het
Sgsm2 G A 11: 74,850,851 R1037W probably damaging Het
Slc22a12 A G 19: 6,542,724 V10A probably benign Het
Spem2 G T 11: 69,816,696 S481* probably null Het
Styk1 C T 6: 131,311,016 G128D probably damaging Het
Tmc6 A T 11: 117,776,328 L148Q probably damaging Het
Tmem138 A C 19: 10,574,835 probably null Het
Tnpo3 A G 6: 29,555,268 V772A probably benign Het
Topaz1 T C 9: 122,797,756 F1483S possibly damaging Het
Tuba4a C A 1: 75,216,055 C305F probably damaging Het
Ubap1 T G 4: 41,379,262 F159V possibly damaging Het
Vmn2r9 A G 5: 108,849,016 I129T probably benign Het
Wwc2 A T 8: 47,856,263 M828K unknown Het
Zfp236 A T 18: 82,671,794 S187T possibly damaging Het
Other mutations in Ptgs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Ptgs2 APN 1 150104424 missense probably damaging 1.00
IGL01626:Ptgs2 APN 1 150103727 missense probably damaging 1.00
IGL01758:Ptgs2 APN 1 150101989 critical splice acceptor site probably null
IGL02168:Ptgs2 APN 1 150103679 splice site probably null
IGL02309:Ptgs2 APN 1 150105556 missense probably damaging 1.00
IGL02363:Ptgs2 APN 1 150105709 splice site probably null
IGL02574:Ptgs2 APN 1 150102775 nonsense probably null
IGL03156:Ptgs2 APN 1 150105477 missense probably damaging 1.00
R0436:Ptgs2 UTSW 1 150104277 unclassified probably benign
R0629:Ptgs2 UTSW 1 150101037 missense probably benign
R0631:Ptgs2 UTSW 1 150104537 missense probably benign 0.30
R0811:Ptgs2 UTSW 1 150101354 missense probably benign 0.03
R0812:Ptgs2 UTSW 1 150101354 missense probably benign 0.03
R0980:Ptgs2 UTSW 1 150104310 missense probably damaging 1.00
R1340:Ptgs2 UTSW 1 150105477 missense probably damaging 1.00
R1626:Ptgs2 UTSW 1 150103868 critical splice acceptor site probably null
R1666:Ptgs2 UTSW 1 150101270 missense probably damaging 1.00
R1742:Ptgs2 UTSW 1 150104399 missense probably damaging 1.00
R1926:Ptgs2 UTSW 1 150100228 missense possibly damaging 0.48
R2148:Ptgs2 UTSW 1 150105714 missense probably benign
R2361:Ptgs2 UTSW 1 150103975 missense probably benign 0.00
R2927:Ptgs2 UTSW 1 150101260 missense possibly damaging 0.95
R3966:Ptgs2 UTSW 1 150105475 missense probably damaging 0.99
R4291:Ptgs2 UTSW 1 150100251 missense probably benign
R4580:Ptgs2 UTSW 1 150104094 missense possibly damaging 0.78
R4668:Ptgs2 UTSW 1 150101084 missense probably benign 0.32
R4751:Ptgs2 UTSW 1 150104020 missense probably damaging 1.00
R4777:Ptgs2 UTSW 1 150105387 missense probably benign 0.03
R5264:Ptgs2 UTSW 1 150102730 missense possibly damaging 0.62
R5570:Ptgs2 UTSW 1 150104108 missense probably damaging 1.00
R5587:Ptgs2 UTSW 1 150105555 missense probably damaging 1.00
R5761:Ptgs2 UTSW 1 150105528 missense probably benign 0.18
R5850:Ptgs2 UTSW 1 150105376 missense probably benign 0.03
R6513:Ptgs2 UTSW 1 150100128 unclassified probably benign
R6553:Ptgs2 UTSW 1 150103987 missense possibly damaging 0.93
R6585:Ptgs2 UTSW 1 150103987 missense possibly damaging 0.93
R6593:Ptgs2 UTSW 1 150101033 missense possibly damaging 0.63
R6772:Ptgs2 UTSW 1 150102078 missense probably damaging 1.00
R6850:Ptgs2 UTSW 1 150105540 missense probably damaging 1.00
R7205:Ptgs2 UTSW 1 150102761 missense probably benign 0.01
R7320:Ptgs2 UTSW 1 150102695 missense probably damaging 1.00
R7567:Ptgs2 UTSW 1 150102697 missense probably damaging 0.99
R7751:Ptgs2 UTSW 1 150104507 missense probably benign 0.14
R7863:Ptgs2 UTSW 1 150101339 missense probably damaging 1.00
R8100:Ptgs2 UTSW 1 150102721 missense probably damaging 1.00
R8117:Ptgs2 UTSW 1 150104034 missense probably damaging 1.00
R8128:Ptgs2 UTSW 1 150101348 missense probably damaging 0.99
Z1176:Ptgs2 UTSW 1 150105721 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAACTATGAAGTTAGGTCCTCTGTG -3'
(R):5'- TGGGTCAGGATGTAGTGCAC -3'

Sequencing Primer
(F):5'- GCTTAAGAATACAAAGTTGCTTGC -3'
(R):5'- CTTGTCAGAAATTCAGCTGGAG -3'
Posted On2017-10-10