Incidental Mutation 'R6137:Nr1h3'
ID488388
Institutional Source Beutler Lab
Gene Symbol Nr1h3
Ensembl Gene ENSMUSG00000002108
Gene Namenuclear receptor subfamily 1, group H, member 3
SynonymsUnr1, LXR alpha
MMRRC Submission 044284-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6137 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location91184061-91202834 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91191851 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 144 (M144K)
Ref Sequence ENSEMBL: ENSMUSP00000106988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002177] [ENSMUST00000111354] [ENSMUST00000111355] [ENSMUST00000111356]
Predicted Effect probably damaging
Transcript: ENSMUST00000002177
AA Change: M144K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002177
Gene: ENSMUSG00000002108
AA Change: M144K

DomainStartEndE-ValueType
ZnF_C4 93 164 1e-35 SMART
low complexity region 189 209 N/A INTRINSIC
HOLI 257 416 1.84e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111354
AA Change: M144K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106986
Gene: ENSMUSG00000002108
AA Change: M144K

DomainStartEndE-ValueType
ZnF_C4 93 164 1e-35 SMART
low complexity region 189 209 N/A INTRINSIC
HOLI 257 416 1.84e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111355
AA Change: M144K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106987
Gene: ENSMUSG00000002108
AA Change: M144K

DomainStartEndE-ValueType
ZnF_C4 93 164 1e-35 SMART
HOLI 202 356 3.76e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111356
AA Change: M144K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106988
Gene: ENSMUSG00000002108
AA Change: M144K

DomainStartEndE-ValueType
ZnF_C4 93 164 1e-35 SMART
low complexity region 189 209 N/A INTRINSIC
HOLI 257 416 1.84e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133261
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150654
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NR1 subfamily of the nuclear receptor superfamily. The NR1 family members are key regulators of macrophage function, controlling transcriptional programs involved in lipid homeostasis and inflammation. This protein is highly expressed in visceral organs, including liver, kidney and intestine. It forms a heterodimer with retinoid X receptor (RXR), and regulates expression of target genes containing retinoid response elements. Studies in mice lacking this gene suggest that it may play an important role in the regulation of cholesterol homeostasis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased male fertility, increased suseceptibility to bacterial infection, and diet-sensitive increase in liver size, steatosis, and cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A T 19: 8,740,784 D6V probably damaging Het
2310057M21Rik G T 7: 131,357,613 H165Q probably damaging Het
Akap13 T A 7: 75,677,416 F721Y probably damaging Het
Akap6 A T 12: 53,140,354 D1517V probably damaging Het
Amigo3 T A 9: 108,053,728 S117T probably damaging Het
Atf7ip2 T A 16: 10,201,411 N34K probably damaging Het
Cacnb1 A C 11: 98,005,782 V351G probably damaging Het
Casp9 T A 4: 141,805,349 probably null Het
Ccdc51 C T 9: 109,089,415 T24I probably benign Het
Cdh23 T A 10: 60,434,512 Y618F probably damaging Het
Chd1 T A 17: 15,758,688 W1271R probably damaging Het
Dars T C 1: 128,368,439 T386A probably benign Het
Dchs1 T A 7: 105,765,106 D834V probably damaging Het
Dgkd T A 1: 87,936,381 V933E possibly damaging Het
Dnah17 A G 11: 118,025,654 F4203S probably damaging Het
Fancm T C 12: 65,130,382 L2000P probably damaging Het
Fbxo11 A T 17: 88,008,669 H444Q probably benign Het
Fbxw14 T A 9: 109,276,222 T292S probably damaging Het
Fer1l6 T C 15: 58,559,206 S237P probably damaging Het
Frem3 T C 8: 80,615,047 I1323T probably benign Het
Grin2a A G 16: 9,653,449 F652L probably benign Het
Grin2b T A 6: 135,923,458 M142L possibly damaging Het
Helz A G 11: 107,619,060 Q503R possibly damaging Het
Ighv5-17 A G 12: 113,859,295 Y69H probably benign Het
Il17ra A G 6: 120,475,582 N242S probably benign Het
Immp1l G C 2: 105,964,208 G117A probably damaging Het
Itm2c T C 1: 85,894,692 V10A probably benign Het
Kif1b T C 4: 149,238,426 K679E possibly damaging Het
Kng1 T C 16: 23,074,645 V256A possibly damaging Het
Lamc2 T G 1: 153,166,153 R78S possibly damaging Het
Loxl4 A G 19: 42,598,793 F621S probably damaging Het
Lpl T A 8: 68,892,747 D134E probably damaging Het
Lypd3 T C 7: 24,640,494 Y329H probably benign Het
Mettl13 T C 1: 162,535,886 D225G probably benign Het
Myo7b A G 18: 31,999,974 F441L probably damaging Het
Nnt T A 13: 119,336,328 M699L possibly damaging Het
Olfr1040 A G 2: 86,145,969 V255A probably benign Het
Olfr1347 T C 7: 6,488,845 T3A probably benign Het
Olfr325 A T 11: 58,581,068 M75L probably benign Het
Pappa2 A T 1: 158,871,543 Y667N probably damaging Het
Prps1l3 A G 12: 57,238,888 I155V probably benign Het
Ptgs2 T A 1: 150,100,993 N24K probably benign Het
Ralgds A T 2: 28,547,588 M514L probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Sacm1l T A 9: 123,569,005 V254D probably damaging Het
Selenot A T 3: 58,585,284 Q64L probably damaging Het
Sgsm2 G A 11: 74,850,851 R1037W probably damaging Het
Slc22a12 A G 19: 6,542,724 V10A probably benign Het
Spem2 G T 11: 69,816,696 S481* probably null Het
Styk1 C T 6: 131,311,016 G128D probably damaging Het
Tmc6 A T 11: 117,776,328 L148Q probably damaging Het
Tmem138 A C 19: 10,574,835 probably null Het
Tnpo3 A G 6: 29,555,268 V772A probably benign Het
Topaz1 T C 9: 122,797,756 F1483S possibly damaging Het
Tuba4a C A 1: 75,216,055 C305F probably damaging Het
Ubap1 T G 4: 41,379,262 F159V possibly damaging Het
Vmn2r9 A G 5: 108,849,016 I129T probably benign Het
Wwc2 A T 8: 47,856,263 M828K unknown Het
Zfp236 A T 18: 82,671,794 S187T possibly damaging Het
Other mutations in Nr1h3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Nr1h3 APN 2 91190199 missense probably damaging 1.00
IGL02198:Nr1h3 APN 2 91192725 missense probably damaging 1.00
IGL02992:Nr1h3 APN 2 91190566 missense probably damaging 1.00
IGL03103:Nr1h3 APN 2 91192015 missense probably damaging 1.00
R0302:Nr1h3 UTSW 2 91192013 missense probably damaging 0.98
R0350:Nr1h3 UTSW 2 91191825 missense possibly damaging 0.68
R2397:Nr1h3 UTSW 2 91191857 missense possibly damaging 0.81
R2439:Nr1h3 UTSW 2 91190220 missense probably benign 0.45
R2988:Nr1h3 UTSW 2 91185004 missense probably damaging 0.96
R3431:Nr1h3 UTSW 2 91191860 missense probably damaging 1.00
R4842:Nr1h3 UTSW 2 91190218 missense probably benign 0.09
R5355:Nr1h3 UTSW 2 91191908 missense possibly damaging 0.67
R6982:Nr1h3 UTSW 2 91190759 missense probably damaging 0.98
R7380:Nr1h3 UTSW 2 91190195 missense possibly damaging 0.83
R7531:Nr1h3 UTSW 2 91184394 missense probably damaging 1.00
R7753:Nr1h3 UTSW 2 91185025 missense probably damaging 1.00
R7980:Nr1h3 UTSW 2 91190884 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGGAAGTTTTAATCCACACTCAGGAG -3'
(R):5'- GTGTCTCTATCCAGAGCTTCG -3'

Sequencing Primer
(F):5'- CACTCAGGAGATCTCTGCAAGTG -3'
(R):5'- GAGCTTCGTCCACAAAAGCGG -3'
Posted On2017-10-10