Incidental Mutation 'R0525:Alms1'
ID 48839
Institutional Source Beutler Lab
Gene Symbol Alms1
Ensembl Gene ENSMUSG00000063810
Gene Name ALMS1, centrosome and basal body associated
Synonyms
MMRRC Submission 038718-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0525 (G1)
Quality Score 122
Status Validated
Chromosome 6
Chromosomal Location 85587531-85702753 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 85587760 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 39 (A39T)
Ref Sequence ENSEMBL: ENSMUSP00000148796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072018] [ENSMUST00000213058]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000072018
AA Change: A39T
SMART Domains Protein: ENSMUSP00000071904
Gene: ENSMUSG00000063810
AA Change: A39T

DomainStartEndE-ValueType
coiled coil region 10 39 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
Blast:MYSc 127 233 1e-21 BLAST
internal_repeat_3 408 511 2.48e-7 PROSPERO
internal_repeat_2 414 804 2.09e-12 PROSPERO
internal_repeat_1 438 834 4.54e-18 PROSPERO
internal_repeat_3 652 757 2.48e-7 PROSPERO
low complexity region 903 908 N/A INTRINSIC
internal_repeat_1 916 1385 4.54e-18 PROSPERO
internal_repeat_2 1024 1390 2.09e-12 PROSPERO
low complexity region 1572 1586 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2760 2773 N/A INTRINSIC
low complexity region 2950 2968 N/A INTRINSIC
low complexity region 3013 3030 N/A INTRINSIC
Pfam:ALMS_motif 3125 3247 1.8e-42 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000213058
AA Change: A39T
Meta Mutation Damage Score 0.0719 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a large tandem-repeat domain as well as additional low complexity regions. The encoded protein functions in microtubule organization, particularly in the formation and maintanance of cilia. Mutations in this gene cause Alstrom syndrome. There is a pseudogene for this gene located adjacent in the same region of chromosome 2. Alternative splice variants have been described but their full length nature has not been determined. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous null mice display obesity starting after puberty, hypogonadism, hyperinsulinemia, male-specific hyperglycemia, retinal dysfunction, and late-onset hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933440M02Rik T A 7: 125,331,499 noncoding transcript Het
A930002H24Rik A G 17: 63,863,647 W49R unknown Het
Abca13 G A 11: 9,293,371 V1745M probably damaging Het
Abca16 T G 7: 120,465,810 Y563* probably null Het
Acot12 C T 13: 91,760,067 probably benign Het
Arid5b T C 10: 68,097,846 D742G possibly damaging Het
Atp1a4 G A 1: 172,239,688 probably benign Het
AU021092 T A 16: 5,217,861 E145V possibly damaging Het
Calr4 A T 4: 109,242,264 probably benign Het
Clip4 T A 17: 71,799,098 probably null Het
Cnpy4 A T 5: 138,192,616 H180L probably benign Het
Cyp2j9 T C 4: 96,579,565 probably null Het
Dgkq A G 5: 108,654,615 S406P probably damaging Het
Dhx8 G A 11: 101,763,928 C1014Y probably damaging Het
Dnah3 T C 7: 119,928,754 Y3824C probably damaging Het
Donson A T 16: 91,686,245 H69Q probably damaging Het
Dppa3 A G 6: 122,629,980 E143G probably damaging Het
Drg1 A G 11: 3,262,545 F96L probably damaging Het
Dvl1 A C 4: 155,855,595 T395P probably damaging Het
Eftud2 A T 11: 102,839,253 V897D probably damaging Het
Enpp6 A G 8: 47,082,443 N341S possibly damaging Het
F11 A G 8: 45,253,049 F100L probably benign Het
Fas T C 19: 34,319,327 Y189H probably damaging Het
Galnt14 G T 17: 73,545,081 S114R probably damaging Het
Gfpt2 A G 11: 49,829,775 I528V probably benign Het
Glt6d1 A G 2: 25,794,268 V242A possibly damaging Het
Grm1 A T 10: 10,719,209 probably benign Het
Gskip G A 12: 105,698,965 A88T probably damaging Het
Gtpbp1 A G 15: 79,713,447 I348V probably benign Het
Hnrnpul1 C A 7: 25,740,883 R316L possibly damaging Het
Il34 T C 8: 110,748,283 E121G probably damaging Het
Lrr1 T C 12: 69,168,911 L19P probably damaging Het
Mat2b A G 11: 40,682,669 probably benign Het
Mettl21e T C 1: 44,206,382 K235E probably damaging Het
Mir124-2hg T A 3: 17,785,529 E126V possibly damaging Het
Myh15 A G 16: 49,132,051 K828R probably benign Het
Myom3 A G 4: 135,764,926 D127G possibly damaging Het
Nek5 C A 8: 22,079,077 probably benign Het
Nudt7 A T 8: 114,151,652 probably null Het
Olfr1056 C T 2: 86,356,275 V36I probably benign Het
Olfr1118 A T 2: 87,309,349 T187S probably benign Het
Olfr1200 G A 2: 88,767,314 Q334* probably null Het
Olfr350 T C 2: 36,850,190 L48P probably damaging Het
Olfr961 T G 9: 39,647,471 C248W probably damaging Het
Phyhd1 A G 2: 30,281,028 H241R probably damaging Het
Pmch T C 10: 88,091,400 probably benign Het
Ror1 A G 4: 100,441,520 S697G probably damaging Het
Rslcan18 A G 13: 67,112,258 V25A probably benign Het
Sema6b T C 17: 56,126,630 H426R probably damaging Het
Serpina3g T C 12: 104,238,339 F9S probably damaging Het
Serpinb12 T A 1: 106,946,702 H52Q probably benign Het
Sh3gl1 T C 17: 56,017,873 K294R probably benign Het
Sidt1 G T 16: 44,259,446 T615K possibly damaging Het
Slc16a4 A C 3: 107,297,939 probably benign Het
Sned1 T A 1: 93,271,974 probably null Het
Sp2 A T 11: 96,956,098 probably benign Het
Steap1 T A 5: 5,742,903 I3F possibly damaging Het
Stxbp5l A T 16: 37,129,797 probably null Het
Tbc1d9 G T 8: 83,268,985 V968F probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Triobp T C 15: 78,973,898 L1233P possibly damaging Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Trpc4ap A G 2: 155,640,478 F531L possibly damaging Het
Ugt1a10 C T 1: 88,218,249 P473L probably damaging Het
Vmn1r86 T C 7: 13,102,161 K213E probably benign Het
Vps8 G A 16: 21,540,109 probably null Het
Wnk1 A T 6: 119,926,564 S2563T probably damaging Het
Yrdc C G 4: 124,851,766 R3G probably damaging Het
Zfp287 A T 11: 62,715,244 V279E probably benign Het
Other mutations in Alms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Alms1 APN 6 85677964 missense probably damaging 1.00
IGL00331:Alms1 APN 6 85641371 missense possibly damaging 0.94
IGL00658:Alms1 APN 6 85628961 missense probably damaging 1.00
IGL00835:Alms1 APN 6 85622134 missense probably damaging 1.00
IGL00930:Alms1 APN 6 85601310 missense probably damaging 0.98
IGL01446:Alms1 APN 6 85696701 missense probably damaging 1.00
IGL01448:Alms1 APN 6 85677899 missense possibly damaging 0.93
IGL01563:Alms1 APN 6 85627983 missense probably damaging 1.00
IGL01632:Alms1 APN 6 85627946 missense probably benign 0.07
IGL01651:Alms1 APN 6 85656476 missense probably benign 0.05
IGL01670:Alms1 APN 6 85678150 missense probably benign 0.00
IGL01716:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01719:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01720:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01723:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01877:Alms1 APN 6 85622411 missense possibly damaging 0.55
IGL01919:Alms1 APN 6 85628004 missense possibly damaging 0.77
IGL01976:Alms1 APN 6 85622665 missense possibly damaging 0.73
IGL02003:Alms1 APN 6 85622223 missense possibly damaging 0.54
IGL02069:Alms1 APN 6 85628823 missense probably benign 0.12
IGL02070:Alms1 APN 6 85651403 missense possibly damaging 0.74
IGL02079:Alms1 APN 6 85628634 missense probably damaging 0.98
IGL02081:Alms1 APN 6 85620303 missense possibly damaging 0.55
IGL02379:Alms1 APN 6 85629633 missense probably damaging 0.98
IGL02412:Alms1 APN 6 85628872 missense possibly damaging 0.91
IGL02606:Alms1 APN 6 85599967 missense probably benign
IGL02636:Alms1 APN 6 85628654 missense probably benign 0.28
IGL02702:Alms1 APN 6 85599849 missense probably benign 0.12
IGL02815:Alms1 APN 6 85667957 critical splice donor site probably null
IGL02926:Alms1 APN 6 85641450 missense probably damaging 1.00
IGL02945:Alms1 APN 6 85620933 missense probably damaging 0.96
IGL02959:Alms1 APN 6 85629052 nonsense probably null
IGL03124:Alms1 APN 6 85678419 missense probably benign 0.03
IGL03199:Alms1 APN 6 85622497 missense possibly damaging 0.68
IGL03209:Alms1 APN 6 85599973 splice site probably benign
IGL03247:Alms1 APN 6 85678597 missense possibly damaging 0.85
ares UTSW 6 85621275 nonsense probably null
ares2 UTSW 6 85677990 nonsense probably null
butterball UTSW 6 85696771 missense probably damaging 0.99
earthquake UTSW 6 85628735 nonsense probably null
fatty UTSW 6 85627934 nonsense probably null
gut_check UTSW 6 85620369 nonsense probably null
portly UTSW 6 85619712 missense probably benign 0.00
replete UTSW 6 85629208 missense possibly damaging 0.87
PIT4468001:Alms1 UTSW 6 85624719 critical splice donor site probably null
R0003:Alms1 UTSW 6 85629210 missense possibly damaging 0.90
R0095:Alms1 UTSW 6 85620253 missense possibly damaging 0.90
R0110:Alms1 UTSW 6 85620369 nonsense probably null
R0114:Alms1 UTSW 6 85619803 missense probably benign 0.00
R0153:Alms1 UTSW 6 85641381 missense possibly damaging 0.94
R0217:Alms1 UTSW 6 85622930 missense probably damaging 0.99
R0328:Alms1 UTSW 6 85610814 splice site probably null
R0410:Alms1 UTSW 6 85587803 missense unknown
R0469:Alms1 UTSW 6 85620369 nonsense probably null
R0491:Alms1 UTSW 6 85702600 missense probably damaging 0.98
R0510:Alms1 UTSW 6 85620369 nonsense probably null
R0522:Alms1 UTSW 6 85621615 missense probably benign
R0611:Alms1 UTSW 6 85678671 missense possibly damaging 0.61
R0637:Alms1 UTSW 6 85623033 missense possibly damaging 0.85
R0718:Alms1 UTSW 6 85621821 missense probably benign 0.00
R0831:Alms1 UTSW 6 85628520 missense probably benign 0.00
R1318:Alms1 UTSW 6 85628549 missense possibly damaging 0.62
R1340:Alms1 UTSW 6 85667957 critical splice donor site probably null
R1561:Alms1 UTSW 6 85629052 nonsense probably null
R1648:Alms1 UTSW 6 85678402 missense probably damaging 0.99
R1697:Alms1 UTSW 6 85622454 missense possibly damaging 0.94
R1699:Alms1 UTSW 6 85622880 missense possibly damaging 0.46
R1715:Alms1 UTSW 6 85629052 nonsense probably null
R1723:Alms1 UTSW 6 85628753 missense probably damaging 1.00
R1734:Alms1 UTSW 6 85641550 critical splice donor site probably null
R1758:Alms1 UTSW 6 85628505 missense probably damaging 0.99
R1804:Alms1 UTSW 6 85621275 nonsense probably null
R1835:Alms1 UTSW 6 85678503 missense possibly damaging 0.94
R1836:Alms1 UTSW 6 85678503 missense possibly damaging 0.94
R2077:Alms1 UTSW 6 85622309 missense possibly damaging 0.93
R2246:Alms1 UTSW 6 85622967 missense possibly damaging 0.91
R2254:Alms1 UTSW 6 85619848 missense probably damaging 1.00
R2280:Alms1 UTSW 6 85677973 missense probably damaging 0.99
R2516:Alms1 UTSW 6 85667963 splice site probably benign
R2519:Alms1 UTSW 6 85667963 splice site probably benign
R2566:Alms1 UTSW 6 85622482 missense possibly damaging 0.84
R2850:Alms1 UTSW 6 85621299 missense probably benign 0.00
R2850:Alms1 UTSW 6 85667963 splice site probably benign
R2932:Alms1 UTSW 6 85620562 missense possibly damaging 0.89
R2944:Alms1 UTSW 6 85628391 missense probably damaging 1.00
R2980:Alms1 UTSW 6 85628835 missense probably damaging 1.00
R3084:Alms1 UTSW 6 85678140 missense probably benign
R3086:Alms1 UTSW 6 85678140 missense probably benign
R3122:Alms1 UTSW 6 85667963 splice site probably benign
R3404:Alms1 UTSW 6 85667963 splice site probably benign
R3405:Alms1 UTSW 6 85667963 splice site probably benign
R3804:Alms1 UTSW 6 85619647 missense probably damaging 1.00
R3904:Alms1 UTSW 6 85621678 missense probably benign 0.00
R4014:Alms1 UTSW 6 85678352 missense probably benign 0.41
R4056:Alms1 UTSW 6 85587803 missense unknown
R4067:Alms1 UTSW 6 85621289 missense probably damaging 1.00
R4110:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4111:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4112:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4194:Alms1 UTSW 6 85677990 nonsense probably null
R4464:Alms1 UTSW 6 85620021 missense possibly damaging 0.66
R4539:Alms1 UTSW 6 85620478 missense possibly damaging 0.78
R4554:Alms1 UTSW 6 85624617 missense probably benign
R4696:Alms1 UTSW 6 85620522 missense probably damaging 1.00
R4825:Alms1 UTSW 6 85678245 missense probably damaging 0.99
R4921:Alms1 UTSW 6 85628546 missense probably benign 0.13
R5030:Alms1 UTSW 6 85627964 missense probably damaging 0.98
R5051:Alms1 UTSW 6 85627934 nonsense probably null
R5085:Alms1 UTSW 6 85620732 missense possibly damaging 0.55
R5141:Alms1 UTSW 6 85621432 missense probably benign 0.01
R5233:Alms1 UTSW 6 85656371 splice site probably null
R5310:Alms1 UTSW 6 85615368 missense possibly damaging 0.79
R5344:Alms1 UTSW 6 85696789 missense probably benign 0.04
R5394:Alms1 UTSW 6 85623088 missense probably benign 0.01
R5460:Alms1 UTSW 6 85696731 missense probably benign 0.08
R5558:Alms1 UTSW 6 85641329 nonsense probably null
R5650:Alms1 UTSW 6 85620271 missense probably damaging 1.00
R5667:Alms1 UTSW 6 85696771 missense probably damaging 0.99
R5671:Alms1 UTSW 6 85629208 missense possibly damaging 0.87
R5688:Alms1 UTSW 6 85599895 missense possibly damaging 0.92
R5815:Alms1 UTSW 6 85622838 missense probably damaging 0.99
R5892:Alms1 UTSW 6 85620903 missense probably damaging 0.99
R5947:Alms1 UTSW 6 85619712 missense probably benign 0.00
R6031:Alms1 UTSW 6 85622955 missense probably damaging 1.00
R6031:Alms1 UTSW 6 85622955 missense probably damaging 1.00
R6144:Alms1 UTSW 6 85623074 missense probably damaging 0.98
R6258:Alms1 UTSW 6 85628735 nonsense probably null
R6260:Alms1 UTSW 6 85628735 nonsense probably null
R6455:Alms1 UTSW 6 85696657 missense probably damaging 0.99
R6569:Alms1 UTSW 6 85641339 missense probably benign 0.07
R6637:Alms1 UTSW 6 85619734 missense possibly damaging 0.78
R6866:Alms1 UTSW 6 85621098 missense possibly damaging 0.85
R6918:Alms1 UTSW 6 85622661 missense possibly damaging 0.87
R7121:Alms1 UTSW 6 85624622 missense probably damaging 1.00
R7179:Alms1 UTSW 6 85621369 missense probably benign 0.09
R7334:Alms1 UTSW 6 85641450 missense probably damaging 0.99
R7376:Alms1 UTSW 6 85622106 missense probably benign 0.10
R7394:Alms1 UTSW 6 85622223 missense possibly damaging 0.54
R7413:Alms1 UTSW 6 85628306 missense probably benign 0.03
R7511:Alms1 UTSW 6 85609425 missense unknown
R7542:Alms1 UTSW 6 85629362 missense possibly damaging 0.62
R7562:Alms1 UTSW 6 85620412 missense probably damaging 1.00
R7575:Alms1 UTSW 6 85622159 missense possibly damaging 0.49
R7577:Alms1 UTSW 6 85615320 missense probably benign 0.09
R7618:Alms1 UTSW 6 85678417 missense probably benign 0.07
R7653:Alms1 UTSW 6 85620595 missense possibly damaging 0.47
R7672:Alms1 UTSW 6 85615351 missense probably damaging 1.00
R7807:Alms1 UTSW 6 85622976 missense possibly damaging 0.91
R7815:Alms1 UTSW 6 85615358 missense probably benign 0.42
R7849:Alms1 UTSW 6 85621497 missense possibly damaging 0.48
R7944:Alms1 UTSW 6 85641380 missense probably benign 0.03
R7954:Alms1 UTSW 6 85621162 missense probably damaging 0.98
R7971:Alms1 UTSW 6 85628679 missense probably benign
R8048:Alms1 UTSW 6 85641334 missense probably benign 0.13
R8223:Alms1 UTSW 6 85643240 nonsense probably null
R8332:Alms1 UTSW 6 85620579 missense probably benign 0.05
R8374:Alms1 UTSW 6 85608991 missense probably benign 0.41
R8470:Alms1 UTSW 6 85641375 missense probably damaging 0.99
R8755:Alms1 UTSW 6 85621574 missense probably benign 0.01
R8979:Alms1 UTSW 6 85621027 missense probably damaging 0.98
R9044:Alms1 UTSW 6 85696753 missense probably damaging 0.98
R9057:Alms1 UTSW 6 85609832 missense unknown
R9224:Alms1 UTSW 6 85621788 missense possibly damaging 0.69
R9259:Alms1 UTSW 6 85667891 missense possibly damaging 0.94
R9401:Alms1 UTSW 6 85678019 nonsense probably null
R9459:Alms1 UTSW 6 85627964 missense probably damaging 0.98
R9633:Alms1 UTSW 6 85623143 missense probably damaging 0.99
R9716:Alms1 UTSW 6 85601252 missense possibly damaging 0.84
R9730:Alms1 UTSW 6 85629438 missense probably benign 0.00
R9790:Alms1 UTSW 6 85619443 missense probably benign 0.04
R9791:Alms1 UTSW 6 85619443 missense probably benign 0.04
R9802:Alms1 UTSW 6 85629238 missense possibly damaging 0.61
X0013:Alms1 UTSW 6 85656455 missense probably damaging 1.00
X0025:Alms1 UTSW 6 85620210 missense probably damaging 0.96
Z1176:Alms1 UTSW 6 85678418 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TACTGTGAGCGAGGTCTAGTGACG -3'
(R):5'- GACCCAGTTCAGTAGCTCAAGCATC -3'

Sequencing Primer
(F):5'- tcgcttcccctcccttc -3'
(R):5'- tgggagggggcagagAG -3'
Posted On 2013-06-12