Mutagenetix > Incidental Mutation

Incidental Mutation 'R6137:Kif1b'

488392

Institutional Source

Beutler Lab

Gene Symbol

Kif1b

Ensembl Gene

ENSMUSG00000063077

Gene Name

kinesin family member 1B

Synonyms

Kif1b beta, KIF1Bp130, A530096N05Rik, D4Mil1e, Kif1b alpha, N-3 kinesin, KIF1Bp204

MMRRC Submission

044284-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6137 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

149176319-149307693 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 149238426 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 679 (K679E)

Ref Sequence

ENSEMBL: ENSMUSP00000030806 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030806] [ENSMUST00000055647] [ENSMUST00000060537]

AlphaFold

Q60575

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030806
AA Change: K679E

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000030806
Gene: ENSMUSG00000063077
AA Change: K679E

Domain	Start	End	E-Value	Type
KISc	3	356	5.85e-176	SMART
low complexity region	389	404	N/A	INTRINSIC
FHA	509	566	1.61e-4	SMART
coiled coil region	626	660	N/A	INTRINSIC
coiled coil region	814	858	N/A	INTRINSIC
low complexity region	889	902	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000055647

SMART Domains

Protein: ENSMUSP00000061472
Gene: ENSMUSG00000063077

Domain	Start	End	E-Value	Type
KISc	3	356	5.85e-176	SMART
low complexity region	389	404	N/A	INTRINSIC
FHA	509	566	1.61e-4	SMART
coiled coil region	626	685	N/A	INTRINSIC
Pfam:KIF1B	799	846	9.7e-13	PFAM
internal_repeat_1	901	933	7.01e-7	PROSPERO
low complexity region	1165	1179	N/A	INTRINSIC
Pfam:DUF3694	1220	1368	1.1e-46	PFAM
low complexity region	1444	1461	N/A	INTRINSIC
low complexity region	1479	1507	N/A	INTRINSIC
low complexity region	1573	1591	N/A	INTRINSIC
PH	1656	1755	1.02e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000060537

SMART Domains

Protein: ENSMUSP00000056754
Gene: ENSMUSG00000063077

Domain	Start	End	E-Value	Type
KISc	3	362	7.61e-175	SMART
low complexity region	390	400	N/A	INTRINSIC
low complexity region	432	450	N/A	INTRINSIC
FHA	555	612	1.61e-4	SMART
coiled coil region	672	731	N/A	INTRINSIC
Pfam:KIF1B	845	892	7.1e-15	PFAM
internal_repeat_1	947	979	4.76e-7	PROSPERO
low complexity region	1211	1225	N/A	INTRINSIC
Pfam:DUF3694	1266	1413	1.1e-40	PFAM
low complexity region	1490	1507	N/A	INTRINSIC
low complexity region	1525	1553	N/A	INTRINSIC
low complexity region	1619	1637	N/A	INTRINSIC
PH	1702	1801	1.02e-14	SMART

Meta Mutation Damage Score

0.0606

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.3%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a motor protein that transports mitochondria and synaptic vesicle precursors. Mutations in this gene cause Charcot-Marie-Tooth disease, type 2A1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced brain size, elevated pain threshold, and neonatal death from apnea. Heterozygotes exhibit impaired synaptic vesicle precursor transport and progressive muscle weakness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700092M07Rik	A	T	19: 8,740,784	D6V	probably damaging	Het
2310057M21Rik	G	T	7: 131,357,613	H165Q	probably damaging	Het
Akap13	T	A	7: 75,677,416	F721Y	probably damaging	Het
Akap6	A	T	12: 53,140,354	D1517V	probably damaging	Het
Amigo3	T	A	9: 108,053,728	S117T	probably damaging	Het
Atf7ip2	T	A	16: 10,201,411	N34K	probably damaging	Het
Cacnb1	A	C	11: 98,005,782	V351G	probably damaging	Het
Casp9	T	A	4: 141,805,349		probably null	Het
Ccdc51	C	T	9: 109,089,415	T24I	probably benign	Het
Cdh23	T	A	10: 60,434,512	Y618F	probably damaging	Het
Chd1	T	A	17: 15,758,688	W1271R	probably damaging	Het
Dars	T	C	1: 128,368,439	T386A	probably benign	Het
Dchs1	T	A	7: 105,765,106	D834V	probably damaging	Het
Dgkd	T	A	1: 87,936,381	V933E	possibly damaging	Het
Dnah17	A	G	11: 118,025,654	F4203S	probably damaging	Het
Fancm	T	C	12: 65,130,382	L2000P	probably damaging	Het
Fbxo11	A	T	17: 88,008,669	H444Q	probably benign	Het
Fbxw14	T	A	9: 109,276,222	T292S	probably damaging	Het
Fer1l6	T	C	15: 58,559,206	S237P	probably damaging	Het
Frem3	T	C	8: 80,615,047	I1323T	probably benign	Het
Grin2a	A	G	16: 9,653,449	F652L	probably benign	Het
Grin2b	T	A	6: 135,923,458	M142L	possibly damaging	Het
Helz	A	G	11: 107,619,060	Q503R	possibly damaging	Het
Ighv5-17	A	G	12: 113,859,295	Y69H	probably benign	Het
Il17ra	A	G	6: 120,475,582	N242S	probably benign	Het
Immp1l	G	C	2: 105,964,208	G117A	probably damaging	Het
Itm2c	T	C	1: 85,894,692	V10A	probably benign	Het
Kng1	T	C	16: 23,074,645	V256A	possibly damaging	Het
Lamc2	T	G	1: 153,166,153	R78S	possibly damaging	Het
Loxl4	A	G	19: 42,598,793	F621S	probably damaging	Het
Lpl	T	A	8: 68,892,747	D134E	probably damaging	Het
Lypd3	T	C	7: 24,640,494	Y329H	probably benign	Het
Mettl13	T	C	1: 162,535,886	D225G	probably benign	Het
Myo7b	A	G	18: 31,999,974	F441L	probably damaging	Het
Nnt	T	A	13: 119,336,328	M699L	possibly damaging	Het
Nr1h3	A	T	2: 91,191,851	M144K	probably damaging	Het
Olfr1040	A	G	2: 86,145,969	V255A	probably benign	Het
Olfr1347	T	C	7: 6,488,845	T3A	probably benign	Het
Olfr325	A	T	11: 58,581,068	M75L	probably benign	Het
Pappa2	A	T	1: 158,871,543	Y667N	probably damaging	Het
Prps1l3	A	G	12: 57,238,888	I155V	probably benign	Het
Ptgs2	T	A	1: 150,100,993	N24K	probably benign	Het
Ralgds	A	T	2: 28,547,588	M514L	probably damaging	Het
Rbm47	G	C	5: 66,026,283	R326G	probably damaging	Het
Sacm1l	T	A	9: 123,569,005	V254D	probably damaging	Het
Selenot	A	T	3: 58,585,284	Q64L	probably damaging	Het
Sgsm2	G	A	11: 74,850,851	R1037W	probably damaging	Het
Slc22a12	A	G	19: 6,542,724	V10A	probably benign	Het
Spem2	G	T	11: 69,816,696	S481*	probably null	Het
Styk1	C	T	6: 131,311,016	G128D	probably damaging	Het
Tmc6	A	T	11: 117,776,328	L148Q	probably damaging	Het
Tmem138	A	C	19: 10,574,835		probably null	Het
Tnpo3	A	G	6: 29,555,268	V772A	probably benign	Het
Topaz1	T	C	9: 122,797,756	F1483S	possibly damaging	Het
Tuba4a	C	A	1: 75,216,055	C305F	probably damaging	Het
Ubap1	T	G	4: 41,379,262	F159V	possibly damaging	Het
Vmn2r9	A	G	5: 108,849,016	I129T	probably benign	Het
Wwc2	A	T	8: 47,856,263	M828K	unknown	Het
Zfp236	A	T	18: 82,671,794	S187T	possibly damaging	Het

Other mutations in Kif1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01311:Kif1b	APN	4	149220602	missense	probably damaging	1.00
IGL01943:Kif1b	APN	4	149214905	critical splice donor site	probably null
IGL02240:Kif1b	APN	4	149246414	missense	probably damaging	1.00
IGL02414:Kif1b	APN	4	149199314	missense	probably damaging	0.96
IGL02490:Kif1b	APN	4	149204208	missense	probably benign
IGL02501:Kif1b	APN	4	149214976	missense	probably damaging	1.00
IGL02833:Kif1b	APN	4	149246364	missense	probably damaging	1.00
IGL02852:Kif1b	APN	4	149291328	missense	probably damaging	1.00
IGL02900:Kif1b	APN	4	149180809	missense	possibly damaging	0.81
IGL03287:Kif1b	APN	4	149214981	missense	possibly damaging	0.67
IGL03412:Kif1b	APN	4	149274939	missense	probably benign	0.00
PIT4305001:Kif1b	UTSW	4	149220792	critical splice acceptor site	probably null
R0005:Kif1b	UTSW	4	149181927	missense	probably damaging	1.00
R0044:Kif1b	UTSW	4	149263601	splice site	probably benign
R0044:Kif1b	UTSW	4	149263601	splice site	probably benign
R0129:Kif1b	UTSW	4	149261201	missense	probably benign
R0180:Kif1b	UTSW	4	149213659	missense	probably damaging	1.00
R0288:Kif1b	UTSW	4	149199338	missense	probably damaging	1.00
R0360:Kif1b	UTSW	4	149262729	missense	probably damaging	1.00
R0383:Kif1b	UTSW	4	149202512	missense	probably damaging	1.00
R0398:Kif1b	UTSW	4	149204231	missense	possibly damaging	0.89
R0403:Kif1b	UTSW	4	149181967	nonsense	probably null
R0445:Kif1b	UTSW	4	149188009	missense	probably benign	0.01
R1466:Kif1b	UTSW	4	149223252	missense	probably damaging	0.99
R1466:Kif1b	UTSW	4	149223252	missense	probably damaging	0.99
R1681:Kif1b	UTSW	4	149195501	critical splice acceptor site	probably null
R1728:Kif1b	UTSW	4	149187722	missense	probably damaging	0.99
R1840:Kif1b	UTSW	4	149188132	missense	probably damaging	1.00
R1874:Kif1b	UTSW	4	149187632	missense	probably benign
R1915:Kif1b	UTSW	4	149267216	missense	probably damaging	1.00
R2106:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2124:Kif1b	UTSW	4	149222296	missense	probably benign	0.08
R2126:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2127:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2128:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2129:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2146:Kif1b	UTSW	4	149184309	missense	probably damaging	0.99
R2255:Kif1b	UTSW	4	149274997	missense	probably damaging	1.00
R2392:Kif1b	UTSW	4	149220620	missense	possibly damaging	0.93
R2883:Kif1b	UTSW	4	149237648	missense	possibly damaging	0.78
R2981:Kif1b	UTSW	4	149220541	critical splice donor site	probably null
R3038:Kif1b	UTSW	4	149213333	missense	probably benign	0.02
R3616:Kif1b	UTSW	4	149262283	splice site	probably benign
R3935:Kif1b	UTSW	4	149237160	missense	probably benign	0.00
R4347:Kif1b	UTSW	4	149247234	missense	probably damaging	1.00
R4423:Kif1b	UTSW	4	149214105	missense	probably damaging	0.99
R4637:Kif1b	UTSW	4	149199311	missense	probably damaging	0.97
R4745:Kif1b	UTSW	4	149237882	nonsense	probably null
R4807:Kif1b	UTSW	4	149247921	intron	probably benign
R5618:Kif1b	UTSW	4	149269889	missense	possibly damaging	0.94
R5644:Kif1b	UTSW	4	149238482	missense	probably damaging	0.96
R5683:Kif1b	UTSW	4	149222261	missense	probably damaging	1.00
R5696:Kif1b	UTSW	4	149273849	splice site	probably null
R6022:Kif1b	UTSW	4	149198532	missense	probably benign	0.01
R6048:Kif1b	UTSW	4	149263629	missense	probably damaging	1.00
R6139:Kif1b	UTSW	4	149237532	missense	possibly damaging	0.88
R6171:Kif1b	UTSW	4	149258048	missense	probably damaging	1.00
R6250:Kif1b	UTSW	4	149213643	missense	probably benign	0.00
R6423:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6424:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6425:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6443:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6460:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6462:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6463:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6469:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6470:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6471:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6472:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6504:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6536:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6537:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6668:Kif1b	UTSW	4	149213407	missense	probably benign	0.09
R6698:Kif1b	UTSW	4	149274956	missense	probably damaging	0.99
R7065:Kif1b	UTSW	4	149202525	missense	possibly damaging	0.46
R7222:Kif1b	UTSW	4	149225157	missense	probably damaging	1.00
R7342:Kif1b	UTSW	4	149214090	missense	possibly damaging	0.94
R7720:Kif1b	UTSW	4	149182355	missense	probably benign	0.01
R7744:Kif1b	UTSW	4	149237075	missense	possibly damaging	0.83
R7797:Kif1b	UTSW	4	149237387	missense	probably benign
R7829:Kif1b	UTSW	4	149220990	splice site	probably null
R7869:Kif1b	UTSW	4	149184376	missense	probably benign	0.01
R7878:Kif1b	UTSW	4	149214997	missense	probably damaging	0.98
R7980:Kif1b	UTSW	4	149269921	missense	probably damaging	1.00
R8047:Kif1b	UTSW	4	149214922	missense	probably damaging	1.00
R8237:Kif1b	UTSW	4	149191185	missense	probably benign	0.10
R8243:Kif1b	UTSW	4	149204267	missense	probably benign
R8252:Kif1b	UTSW	4	149273805	missense	probably damaging	1.00
R8342:Kif1b	UTSW	4	149222348	missense	probably damaging	0.96
R8460:Kif1b	UTSW	4	149187620	missense	possibly damaging	0.93
R8462:Kif1b	UTSW	4	149182340	missense	probably benign	0.05
R8496:Kif1b	UTSW	4	149192611	nonsense	probably null
R8687:Kif1b	UTSW	4	149261163	nonsense	probably null
R8694:Kif1b	UTSW	4	149220567	missense	probably damaging	0.98
R8842:Kif1b	UTSW	4	149253739	missense	probably damaging	0.98
R8883:Kif1b	UTSW	4	149276885	missense	probably benign
R8971:Kif1b	UTSW	4	149247816	missense	probably damaging	1.00
R8994:Kif1b	UTSW	4	149195482	missense
R9002:Kif1b	UTSW	4	149191255	missense	probably damaging	0.96
R9227:Kif1b	UTSW	4	149237900	missense	probably damaging	1.00
R9231:Kif1b	UTSW	4	149191195	missense	possibly damaging	0.94
R9450:Kif1b	UTSW	4	149238010	missense	probably benign	0.01
R9478:Kif1b	UTSW	4	149261159	critical splice donor site	probably null
R9571:Kif1b	UTSW	4	149220641	missense	probably damaging	1.00
R9644:Kif1b	UTSW	4	149291379	missense	probably damaging	1.00
RF008:Kif1b	UTSW	4	149251738	splice site	probably null
X0009:Kif1b	UTSW	4	149247264	missense	probably damaging	1.00
X0062:Kif1b	UTSW	4	149275005	missense	probably damaging	1.00
Z1176:Kif1b	UTSW	4	149266298	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- TAAGATCTGAGATGGTGACCCAC -3'
(R):5'- CAGCCCTCCAAGAATGTGTTTC -3'

Sequencing Primer
(F):5'- ATGGTGACCCACTTGGAATC -3'
(R):5'- CCAAGAATGTGTTTCATTTATCCCAG -3'

Posted On

2017-10-10