Incidental Mutation 'R6137:Rbm47'
ID488393
Institutional Source Beutler Lab
Gene Symbol Rbm47
Ensembl Gene ENSMUSG00000070780
Gene NameRNA binding motif protein 47
Synonyms
MMRRC Submission 044284-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R6137 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location66016549-66173118 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 66026283 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 326 (R326G)
Ref Sequence ENSEMBL: ENSMUSP00000144122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094756] [ENSMUST00000094757] [ENSMUST00000113724] [ENSMUST00000113726] [ENSMUST00000167950] [ENSMUST00000200775] [ENSMUST00000200852] [ENSMUST00000201544] [ENSMUST00000201561] [ENSMUST00000202700]
Predicted Effect probably damaging
Transcript: ENSMUST00000094756
AA Change: R326G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000092348
Gene: ENSMUSG00000070780
AA Change: R326G

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094757
AA Change: R326G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092349
Gene: ENSMUSG00000070780
AA Change: R326G

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113724
AA Change: R326G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109353
Gene: ENSMUSG00000070780
AA Change: R326G

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113726
AA Change: R326G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109355
Gene: ENSMUSG00000070780
AA Change: R326G

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167950
AA Change: R326G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128016
Gene: ENSMUSG00000070780
AA Change: R326G

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200775
AA Change: R326G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144325
Gene: ENSMUSG00000070780
AA Change: R326G

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200852
SMART Domains Protein: ENSMUSP00000144505
Gene: ENSMUSG00000070780

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201311
Predicted Effect probably damaging
Transcript: ENSMUST00000201544
AA Change: R326G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144122
Gene: ENSMUSG00000070780
AA Change: R326G

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201561
Predicted Effect probably benign
Transcript: ENSMUST00000202700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202794
Meta Mutation Damage Score 0.4376 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (58/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit partial prenatal lethality. Surviving adults are small and display impaired cytidine to uridine RNA editing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A T 19: 8,740,784 D6V probably damaging Het
2310057M21Rik G T 7: 131,357,613 H165Q probably damaging Het
Akap13 T A 7: 75,677,416 F721Y probably damaging Het
Akap6 A T 12: 53,140,354 D1517V probably damaging Het
Amigo3 T A 9: 108,053,728 S117T probably damaging Het
Atf7ip2 T A 16: 10,201,411 N34K probably damaging Het
Cacnb1 A C 11: 98,005,782 V351G probably damaging Het
Casp9 T A 4: 141,805,349 probably null Het
Ccdc51 C T 9: 109,089,415 T24I probably benign Het
Cdh23 T A 10: 60,434,512 Y618F probably damaging Het
Chd1 T A 17: 15,758,688 W1271R probably damaging Het
Dars T C 1: 128,368,439 T386A probably benign Het
Dchs1 T A 7: 105,765,106 D834V probably damaging Het
Dgkd T A 1: 87,936,381 V933E possibly damaging Het
Dnah17 A G 11: 118,025,654 F4203S probably damaging Het
Fancm T C 12: 65,130,382 L2000P probably damaging Het
Fbxo11 A T 17: 88,008,669 H444Q probably benign Het
Fbxw14 T A 9: 109,276,222 T292S probably damaging Het
Fer1l6 T C 15: 58,559,206 S237P probably damaging Het
Frem3 T C 8: 80,615,047 I1323T probably benign Het
Grin2a A G 16: 9,653,449 F652L probably benign Het
Grin2b T A 6: 135,923,458 M142L possibly damaging Het
Helz A G 11: 107,619,060 Q503R possibly damaging Het
Ighv5-17 A G 12: 113,859,295 Y69H probably benign Het
Il17ra A G 6: 120,475,582 N242S probably benign Het
Immp1l G C 2: 105,964,208 G117A probably damaging Het
Itm2c T C 1: 85,894,692 V10A probably benign Het
Kif1b T C 4: 149,238,426 K679E possibly damaging Het
Kng1 T C 16: 23,074,645 V256A possibly damaging Het
Lamc2 T G 1: 153,166,153 R78S possibly damaging Het
Loxl4 A G 19: 42,598,793 F621S probably damaging Het
Lpl T A 8: 68,892,747 D134E probably damaging Het
Lypd3 T C 7: 24,640,494 Y329H probably benign Het
Mettl13 T C 1: 162,535,886 D225G probably benign Het
Myo7b A G 18: 31,999,974 F441L probably damaging Het
Nnt T A 13: 119,336,328 M699L possibly damaging Het
Nr1h3 A T 2: 91,191,851 M144K probably damaging Het
Olfr1040 A G 2: 86,145,969 V255A probably benign Het
Olfr1347 T C 7: 6,488,845 T3A probably benign Het
Olfr325 A T 11: 58,581,068 M75L probably benign Het
Pappa2 A T 1: 158,871,543 Y667N probably damaging Het
Prps1l3 A G 12: 57,238,888 I155V probably benign Het
Ptgs2 T A 1: 150,100,993 N24K probably benign Het
Ralgds A T 2: 28,547,588 M514L probably damaging Het
Sacm1l T A 9: 123,569,005 V254D probably damaging Het
Selenot A T 3: 58,585,284 Q64L probably damaging Het
Sgsm2 G A 11: 74,850,851 R1037W probably damaging Het
Slc22a12 A G 19: 6,542,724 V10A probably benign Het
Spem2 G T 11: 69,816,696 S481* probably null Het
Styk1 C T 6: 131,311,016 G128D probably damaging Het
Tmc6 A T 11: 117,776,328 L148Q probably damaging Het
Tmem138 A C 19: 10,574,835 probably null Het
Tnpo3 A G 6: 29,555,268 V772A probably benign Het
Topaz1 T C 9: 122,797,756 F1483S possibly damaging Het
Tuba4a C A 1: 75,216,055 C305F probably damaging Het
Ubap1 T G 4: 41,379,262 F159V possibly damaging Het
Vmn2r9 A G 5: 108,849,016 I129T probably benign Het
Wwc2 A T 8: 47,856,263 M828K unknown Het
Zfp236 A T 18: 82,671,794 S187T possibly damaging Het
Other mutations in Rbm47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Rbm47 APN 5 66026738 missense possibly damaging 0.75
IGL01648:Rbm47 APN 5 66024978 missense possibly damaging 0.59
IGL02323:Rbm47 APN 5 66026429 missense probably damaging 1.00
IGL02456:Rbm47 APN 5 66027021 missense probably damaging 1.00
IGL03329:Rbm47 APN 5 66026693 missense probably damaging 0.98
PIT4402001:Rbm47 UTSW 5 66027011 missense probably damaging 1.00
R0131:Rbm47 UTSW 5 66026529 missense possibly damaging 0.86
R1575:Rbm47 UTSW 5 66025015 missense probably benign 0.00
R1587:Rbm47 UTSW 5 66024991 missense probably benign 0.23
R1645:Rbm47 UTSW 5 66027138 missense probably benign 0.44
R1750:Rbm47 UTSW 5 66019310 missense possibly damaging 0.78
R4085:Rbm47 UTSW 5 66022737 missense probably benign 0.05
R4087:Rbm47 UTSW 5 66022737 missense probably benign 0.05
R4090:Rbm47 UTSW 5 66022737 missense probably benign 0.05
R4280:Rbm47 UTSW 5 66026177 missense probably damaging 1.00
R4714:Rbm47 UTSW 5 66025052 missense probably damaging 1.00
R4744:Rbm47 UTSW 5 66026693 missense probably damaging 0.98
R4807:Rbm47 UTSW 5 66019304 missense possibly damaging 0.71
R5453:Rbm47 UTSW 5 66027182 missense probably benign 0.07
R6090:Rbm47 UTSW 5 66026283 missense probably damaging 1.00
R6091:Rbm47 UTSW 5 66026283 missense probably damaging 1.00
R6136:Rbm47 UTSW 5 66026283 missense probably damaging 1.00
R6159:Rbm47 UTSW 5 66026816 missense probably damaging 0.99
R6181:Rbm47 UTSW 5 66026490 missense possibly damaging 0.92
R6425:Rbm47 UTSW 5 66022816 missense probably damaging 1.00
R7292:Rbm47 UTSW 5 66026750 missense possibly damaging 0.86
R7332:Rbm47 UTSW 5 66026214 missense probably damaging 1.00
R7405:Rbm47 UTSW 5 66026495 missense probably damaging 0.98
R8114:Rbm47 UTSW 5 66026853 missense probably benign 0.00
R8348:Rbm47 UTSW 5 66027230 missense possibly damaging 0.60
R8448:Rbm47 UTSW 5 66027230 missense possibly damaging 0.60
R8674:Rbm47 UTSW 5 66019399 missense possibly damaging 0.63
Z1176:Rbm47 UTSW 5 66022672 missense probably benign 0.04
Z1176:Rbm47 UTSW 5 66026979 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TCAATCTAACACCCTTGTCTAGG -3'
(R):5'- GAGCTTTGGCCAGTTCAACC -3'

Sequencing Primer
(F):5'- CTTGTCTAGGGGGCTGGACAC -3'
(R):5'- AGTTCAACCCAGGCTGCG -3'
Posted On2017-10-10