Incidental Mutation 'R6137:Vmn2r9'
ID488394
Institutional Source Beutler Lab
Gene Symbol Vmn2r9
Ensembl Gene ENSMUSG00000091624
Gene Namevomeronasal 2, receptor 9
SynonymsEG435864
MMRRC Submission 044284-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R6137 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location108842947-108852510 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108849016 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 129 (I129T)
Ref Sequence ENSEMBL: ENSMUSP00000129520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170419]
Predicted Effect probably benign
Transcript: ENSMUST00000170419
AA Change: I129T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000129520
Gene: ENSMUSG00000091624
AA Change: I129T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 77 412 8.1e-29 PFAM
Pfam:NCD3G 507 561 2.3e-16 PFAM
Pfam:7tm_3 592 829 3.4e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176157
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A T 19: 8,740,784 D6V probably damaging Het
2310057M21Rik G T 7: 131,357,613 H165Q probably damaging Het
Akap13 T A 7: 75,677,416 F721Y probably damaging Het
Akap6 A T 12: 53,140,354 D1517V probably damaging Het
Amigo3 T A 9: 108,053,728 S117T probably damaging Het
Atf7ip2 T A 16: 10,201,411 N34K probably damaging Het
Cacnb1 A C 11: 98,005,782 V351G probably damaging Het
Casp9 T A 4: 141,805,349 probably null Het
Ccdc51 C T 9: 109,089,415 T24I probably benign Het
Cdh23 T A 10: 60,434,512 Y618F probably damaging Het
Chd1 T A 17: 15,758,688 W1271R probably damaging Het
Dars T C 1: 128,368,439 T386A probably benign Het
Dchs1 T A 7: 105,765,106 D834V probably damaging Het
Dgkd T A 1: 87,936,381 V933E possibly damaging Het
Dnah17 A G 11: 118,025,654 F4203S probably damaging Het
Fancm T C 12: 65,130,382 L2000P probably damaging Het
Fbxo11 A T 17: 88,008,669 H444Q probably benign Het
Fbxw14 T A 9: 109,276,222 T292S probably damaging Het
Fer1l6 T C 15: 58,559,206 S237P probably damaging Het
Frem3 T C 8: 80,615,047 I1323T probably benign Het
Grin2a A G 16: 9,653,449 F652L probably benign Het
Grin2b T A 6: 135,923,458 M142L possibly damaging Het
Helz A G 11: 107,619,060 Q503R possibly damaging Het
Ighv5-17 A G 12: 113,859,295 Y69H probably benign Het
Il17ra A G 6: 120,475,582 N242S probably benign Het
Immp1l G C 2: 105,964,208 G117A probably damaging Het
Itm2c T C 1: 85,894,692 V10A probably benign Het
Kif1b T C 4: 149,238,426 K679E possibly damaging Het
Kng1 T C 16: 23,074,645 V256A possibly damaging Het
Lamc2 T G 1: 153,166,153 R78S possibly damaging Het
Loxl4 A G 19: 42,598,793 F621S probably damaging Het
Lpl T A 8: 68,892,747 D134E probably damaging Het
Lypd3 T C 7: 24,640,494 Y329H probably benign Het
Mettl13 T C 1: 162,535,886 D225G probably benign Het
Myo7b A G 18: 31,999,974 F441L probably damaging Het
Nnt T A 13: 119,336,328 M699L possibly damaging Het
Nr1h3 A T 2: 91,191,851 M144K probably damaging Het
Olfr1040 A G 2: 86,145,969 V255A probably benign Het
Olfr1347 T C 7: 6,488,845 T3A probably benign Het
Olfr325 A T 11: 58,581,068 M75L probably benign Het
Pappa2 A T 1: 158,871,543 Y667N probably damaging Het
Prps1l3 A G 12: 57,238,888 I155V probably benign Het
Ptgs2 T A 1: 150,100,993 N24K probably benign Het
Ralgds A T 2: 28,547,588 M514L probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Sacm1l T A 9: 123,569,005 V254D probably damaging Het
Selenot A T 3: 58,585,284 Q64L probably damaging Het
Sgsm2 G A 11: 74,850,851 R1037W probably damaging Het
Slc22a12 A G 19: 6,542,724 V10A probably benign Het
Spem2 G T 11: 69,816,696 S481* probably null Het
Styk1 C T 6: 131,311,016 G128D probably damaging Het
Tmc6 A T 11: 117,776,328 L148Q probably damaging Het
Tmem138 A C 19: 10,574,835 probably null Het
Tnpo3 A G 6: 29,555,268 V772A probably benign Het
Topaz1 T C 9: 122,797,756 F1483S possibly damaging Het
Tuba4a C A 1: 75,216,055 C305F probably damaging Het
Ubap1 T G 4: 41,379,262 F159V possibly damaging Het
Wwc2 A T 8: 47,856,263 M828K unknown Het
Zfp236 A T 18: 82,671,794 S187T possibly damaging Het
Other mutations in Vmn2r9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Vmn2r9 APN 5 108848024 missense possibly damaging 0.79
IGL00972:Vmn2r9 APN 5 108849037 missense probably benign 0.02
IGL01102:Vmn2r9 APN 5 108842945 unclassified probably null
IGL01892:Vmn2r9 APN 5 108847834 missense probably damaging 1.00
IGL02086:Vmn2r9 APN 5 108847567 missense probably damaging 1.00
IGL02118:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02119:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02120:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02121:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02123:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02131:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02132:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02171:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02185:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02186:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02346:Vmn2r9 APN 5 108842984 missense probably benign 0.07
IGL02508:Vmn2r9 APN 5 108848201 missense possibly damaging 0.70
IGL02815:Vmn2r9 APN 5 108842990 missense possibly damaging 0.69
IGL03077:Vmn2r9 APN 5 108848307 splice site probably benign
IGL03269:Vmn2r9 APN 5 108847954 missense probably damaging 1.00
IGL03293:Vmn2r9 APN 5 108848131 missense probably damaging 1.00
R0112:Vmn2r9 UTSW 5 108843125 missense probably damaging 1.00
R0328:Vmn2r9 UTSW 5 108847539 missense probably benign 0.11
R0382:Vmn2r9 UTSW 5 108847597 missense probably damaging 1.00
R0521:Vmn2r9 UTSW 5 108848288 nonsense probably null
R0975:Vmn2r9 UTSW 5 108843303 missense probably damaging 1.00
R1216:Vmn2r9 UTSW 5 108847574 missense probably damaging 1.00
R1458:Vmn2r9 UTSW 5 108848984 missense probably benign 0.44
R1469:Vmn2r9 UTSW 5 108843828 missense probably benign
R1469:Vmn2r9 UTSW 5 108843828 missense probably benign
R1704:Vmn2r9 UTSW 5 108846400 missense probably damaging 1.00
R1967:Vmn2r9 UTSW 5 108847522 missense probably benign 0.03
R1991:Vmn2r9 UTSW 5 108846439 missense probably damaging 0.99
R2410:Vmn2r9 UTSW 5 108848257 missense probably damaging 1.00
R3419:Vmn2r9 UTSW 5 108846433 missense probably damaging 0.96
R3852:Vmn2r9 UTSW 5 108848131 missense probably damaging 1.00
R3873:Vmn2r9 UTSW 5 108847835 missense probably benign 0.14
R3905:Vmn2r9 UTSW 5 108847919 missense probably benign 0.37
R3908:Vmn2r9 UTSW 5 108847919 missense probably benign 0.37
R3921:Vmn2r9 UTSW 5 108849055 missense probably benign
R4156:Vmn2r9 UTSW 5 108847877 missense possibly damaging 0.64
R4477:Vmn2r9 UTSW 5 108846277 missense probably benign
R4478:Vmn2r9 UTSW 5 108846277 missense probably benign
R4544:Vmn2r9 UTSW 5 108847685 missense probably benign 0.00
R4546:Vmn2r9 UTSW 5 108847685 missense probably benign 0.00
R4627:Vmn2r9 UTSW 5 108847597 missense probably damaging 1.00
R5215:Vmn2r9 UTSW 5 108846485 missense probably benign 0.03
R5361:Vmn2r9 UTSW 5 108848063 missense probably damaging 1.00
R5587:Vmn2r9 UTSW 5 108847561 missense probably damaging 1.00
R6054:Vmn2r9 UTSW 5 108848260 missense probably damaging 0.99
R6106:Vmn2r9 UTSW 5 108845036 missense probably benign
R6125:Vmn2r9 UTSW 5 108842970 missense probably benign 0.01
R6920:Vmn2r9 UTSW 5 108849046 missense possibly damaging 0.72
R7579:Vmn2r9 UTSW 5 108845082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGCAGGCACATGTAAATGG -3'
(R):5'- CTGCAAGAAGATATGAGTTCTTTCTGG -3'

Sequencing Primer
(F):5'- GAGGTCCTAAGTTCAATTCCCAGG -3'
(R):5'- GGTCAGTGTGGAGATGAAT -3'
Posted On2017-10-10