Mutagenetix > Incidental Mutations

Incidental Mutation 'R6137:Il17ra'

488396

Institutional Source

Beutler Lab

Gene Symbol

Il17ra

Ensembl Gene

ENSMUSG00000002897

Gene Name

interleukin 17 receptor A

Synonyms

VDw217, Il17r

MMRRC Submission

044284-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R6137 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

120463247-120487559 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 120475582 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 242 (N242S)

Ref Sequence

ENSEMBL: ENSMUSP00000002976 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002976]

Predicted Effect

probably benign
Transcript: ENSMUST00000002976
AA Change: N242S

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000002976
Gene: ENSMUSG00000002897
AA Change: N242S

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
Pfam:IL17R_fnIII_D1	48	198	1.3e-70	PFAM
Pfam:IL17R_fnIII_D2	199	303	9.6e-53	PFAM
transmembrane domain	321	343	N/A	INTRINSIC
Pfam:SEFIR	380	539	1.5e-51	PFAM
low complexity region	747	765	N/A	INTRINSIC
low complexity region	801	830	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204078

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204239

Meta Mutation Damage Score

0.1112

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.3%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interleukin 17A (IL17A) is a proinflammatory cytokine secreted by activated T-lymphocytes. It is a potent inducer of the maturation of CD34-positive hematopoietic precursors into neutrophils. The transmembrane protein encoded by this gene (interleukin 17A receptor; IL17RA) is a ubiquitous type I membrane glycoprotein that binds with low affinity to interleukin 17A. Interleukin 17A and its receptor play a pathogenic role in many inflammatory and autoimmune diseases such as rheumatoid arthritis. Like other cytokine receptors, this receptor likely has a multimeric structure. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed neutrophil recruitment and enhanced susceptibility to intranasal infection by Klibsiella pneumoniae. Mice homozygous for a different knock-out allele exhibit delayed and milder IMQ-induced psoriasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700092M07Rik	A	T	19: 8,740,784	D6V	probably damaging	Het
2310057M21Rik	G	T	7: 131,357,613	H165Q	probably damaging	Het
Akap13	T	A	7: 75,677,416	F721Y	probably damaging	Het
Akap6	A	T	12: 53,140,354	D1517V	probably damaging	Het
Amigo3	T	A	9: 108,053,728	S117T	probably damaging	Het
Atf7ip2	T	A	16: 10,201,411	N34K	probably damaging	Het
Cacnb1	A	C	11: 98,005,782	V351G	probably damaging	Het
Casp9	T	A	4: 141,805,349		probably null	Het
Ccdc51	C	T	9: 109,089,415	T24I	probably benign	Het
Cdh23	T	A	10: 60,434,512	Y618F	probably damaging	Het
Chd1	T	A	17: 15,758,688	W1271R	probably damaging	Het
Dars	T	C	1: 128,368,439	T386A	probably benign	Het
Dchs1	T	A	7: 105,765,106	D834V	probably damaging	Het
Dgkd	T	A	1: 87,936,381	V933E	possibly damaging	Het
Dnah17	A	G	11: 118,025,654	F4203S	probably damaging	Het
Fancm	T	C	12: 65,130,382	L2000P	probably damaging	Het
Fbxo11	A	T	17: 88,008,669	H444Q	probably benign	Het
Fbxw14	T	A	9: 109,276,222	T292S	probably damaging	Het
Fer1l6	T	C	15: 58,559,206	S237P	probably damaging	Het
Frem3	T	C	8: 80,615,047	I1323T	probably benign	Het
Grin2a	A	G	16: 9,653,449	F652L	probably benign	Het
Grin2b	T	A	6: 135,923,458	M142L	possibly damaging	Het
Helz	A	G	11: 107,619,060	Q503R	possibly damaging	Het
Ighv5-17	A	G	12: 113,859,295	Y69H	probably benign	Het
Immp1l	G	C	2: 105,964,208	G117A	probably damaging	Het
Itm2c	T	C	1: 85,894,692	V10A	probably benign	Het
Kif1b	T	C	4: 149,238,426	K679E	possibly damaging	Het
Kng1	T	C	16: 23,074,645	V256A	possibly damaging	Het
Lamc2	T	G	1: 153,166,153	R78S	possibly damaging	Het
Loxl4	A	G	19: 42,598,793	F621S	probably damaging	Het
Lpl	T	A	8: 68,892,747	D134E	probably damaging	Het
Lypd3	T	C	7: 24,640,494	Y329H	probably benign	Het
Mettl13	T	C	1: 162,535,886	D225G	probably benign	Het
Myo7b	A	G	18: 31,999,974	F441L	probably damaging	Het
Nnt	T	A	13: 119,336,328	M699L	possibly damaging	Het
Nr1h3	A	T	2: 91,191,851	M144K	probably damaging	Het
Olfr1040	A	G	2: 86,145,969	V255A	probably benign	Het
Olfr1347	T	C	7: 6,488,845	T3A	probably benign	Het
Olfr325	A	T	11: 58,581,068	M75L	probably benign	Het
Pappa2	A	T	1: 158,871,543	Y667N	probably damaging	Het
Prps1l3	A	G	12: 57,238,888	I155V	probably benign	Het
Ptgs2	T	A	1: 150,100,993	N24K	probably benign	Het
Ralgds	A	T	2: 28,547,588	M514L	probably damaging	Het
Rbm47	G	C	5: 66,026,283	R326G	probably damaging	Het
Sacm1l	T	A	9: 123,569,005	V254D	probably damaging	Het
Selenot	A	T	3: 58,585,284	Q64L	probably damaging	Het
Sgsm2	G	A	11: 74,850,851	R1037W	probably damaging	Het
Slc22a12	A	G	19: 6,542,724	V10A	probably benign	Het
Spem2	G	T	11: 69,816,696	S481*	probably null	Het
Styk1	C	T	6: 131,311,016	G128D	probably damaging	Het
Tmc6	A	T	11: 117,776,328	L148Q	probably damaging	Het
Tmem138	A	C	19: 10,574,835		probably null	Het
Tnpo3	A	G	6: 29,555,268	V772A	probably benign	Het
Topaz1	T	C	9: 122,797,756	F1483S	possibly damaging	Het
Tuba4a	C	A	1: 75,216,055	C305F	probably damaging	Het
Ubap1	T	G	4: 41,379,262	F159V	possibly damaging	Het
Vmn2r9	A	G	5: 108,849,016	I129T	probably benign	Het
Wwc2	A	T	8: 47,856,263	M828K	unknown	Het
Zfp236	A	T	18: 82,671,794	S187T	possibly damaging	Het

Other mutations in Il17ra

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01367:Il17ra	APN	6	120481465	missense	probably damaging	1.00
IGL01413:Il17ra	APN	6	120475581	missense	probably benign	0.00
IGL01418:Il17ra	APN	6	120475581	missense	probably benign	0.00
IGL03215:Il17ra	APN	6	120472114	missense	probably damaging	1.00
IGL03047:Il17ra	UTSW	6	120481226	missense	probably damaging	1.00
PIT4305001:Il17ra	UTSW	6	120481406	missense	probably damaging	1.00
R0042:Il17ra	UTSW	6	120472125	splice site	probably benign
R0042:Il17ra	UTSW	6	120472125	splice site	probably benign
R0365:Il17ra	UTSW	6	120478449	missense	probably benign	0.03
R0391:Il17ra	UTSW	6	120476979	splice site	probably benign
R0470:Il17ra	UTSW	6	120481806	missense	probably benign	0.01
R0599:Il17ra	UTSW	6	120481505	missense	probably damaging	1.00
R1525:Il17ra	UTSW	6	120473790	missense	probably damaging	0.98
R1900:Il17ra	UTSW	6	120477394	critical splice acceptor site	probably null
R1972:Il17ra	UTSW	6	120482216	missense	probably benign	0.01
R4192:Il17ra	UTSW	6	120481511	missense	probably damaging	1.00
R4923:Il17ra	UTSW	6	120477445	missense	possibly damaging	0.94
R5009:Il17ra	UTSW	6	120482207	missense	probably benign	0.00
R5133:Il17ra	UTSW	6	120481553	missense	possibly damaging	0.81
R5411:Il17ra	UTSW	6	120481442	missense	probably damaging	1.00
R5548:Il17ra	UTSW	6	120478473	missense	probably benign	0.23
R6190:Il17ra	UTSW	6	120475273	missense	probably damaging	1.00
R7202:Il17ra	UTSW	6	120475611	missense	probably benign	0.01
R7300:Il17ra	UTSW	6	120482102	missense	probably benign	0.00
R8130:Il17ra	UTSW	6	120478455	missense	probably benign	0.01
R8152:Il17ra	UTSW	6	120482102	missense	probably benign	0.00
R8213:Il17ra	UTSW	6	120473034	missense	probably benign	0.39
R8525:Il17ra	UTSW	6	120474337	nonsense	probably null
R8560:Il17ra	UTSW	6	120482265	missense	possibly damaging	0.78
R8675:Il17ra	UTSW	6	120481988	missense	probably benign	0.05
R8754:Il17ra	UTSW	6	120481456	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- CGCACTCAGTAACTTTAACTTGC -3'
(R):5'- AAGAGAGCTACCAAGTGTGCC -3'

Sequencing Primer
(F):5'- TGTGTACTGGCCCATACACACATG -3'
(R):5'- TACCAAGTGTGCCTGAGTCCAG -3'

Posted On

2017-10-10