Mutagenetix > Incidental Mutations

Incidental Mutation 'R6137:Akap13'

488401

Institutional Source

Beutler Lab

Gene Symbol

Akap13

Ensembl Gene

ENSMUSG00000066406

Gene Name

A kinase (PRKA) anchor protein 13

Synonyms

AKAP-Lbc, 5730522G15Rik, 1700026G02Rik, PROTO-LBC, PROTO-LB, Ht31, 5830460E08Rik

MMRRC Submission

044284-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6137 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

75455534-75754609 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 75677416 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Tyrosine at position 721 (F721Y)

Ref Sequence

ENSEMBL: ENSMUSP00000146990 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166315] [ENSMUST00000207750] [ENSMUST00000207923]

Predicted Effect

probably damaging
Transcript: ENSMUST00000166315
AA Change: F1528Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129784
Gene: ENSMUSG00000066406
AA Change: F1528Y

Domain	Start	End	E-Value	Type
low complexity region	174	184	N/A	INTRINSIC
low complexity region	773	789	N/A	INTRINSIC
low complexity region	896	908	N/A	INTRINSIC
low complexity region	1021	1032	N/A	INTRINSIC
low complexity region	1433	1448	N/A	INTRINSIC
low complexity region	1483	1505	N/A	INTRINSIC
low complexity region	1583	1594	N/A	INTRINSIC
low complexity region	1720	1750	N/A	INTRINSIC
C1	1755	1801	1.95e-4	SMART
low complexity region	1858	1869	N/A	INTRINSIC
RhoGEF	1961	2153	1.28e-61	SMART
PH	2195	2298	2.94e-11	SMART
coiled coil region	2308	2345	N/A	INTRINSIC
low complexity region	2393	2412	N/A	INTRINSIC
low complexity region	2444	2454	N/A	INTRINSIC
coiled coil region	2533	2646	N/A	INTRINSIC
low complexity region	2728	2734	N/A	INTRINSIC
low complexity region	2740	2753	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207079

Predicted Effect

probably damaging
Transcript: ENSMUST00000207750
AA Change: F1524Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000207923
AA Change: F721Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

unknown
Transcript: ENSMUST00000207998
AA Change: F223Y

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208053

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208456

Predicted Effect

unknown
Transcript: ENSMUST00000208708
AA Change: F366Y

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209040

Meta Mutation Damage Score

0.1477

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.3%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms containing c-terminal dbl oncogene homology (DH) and pleckstrin homology (PH) domains. The DH domain is associated with guanine nucleotide exchange activation for the Rho/Rac family of small GTP binding proteins, resulting in the conversion of the inactive GTPase to the active form capable of transducing signals. The PH domain has multiple functions. Therefore, these isoforms function as scaffolding proteins to coordinate a Rho signaling pathway, function as protein kinase A-anchoring proteins and, in addition, enhance ligand-dependent activity of estrogen receptors alpha and beta. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, arrested heart development, and forebrain hypoplasia. Heterozygous mice exhibit small spleen, impaired lymphocyte response to osmotic stress, decreased response to glucocorticoid, osteoporosis and impared osteogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700092M07Rik	A	T	19: 8,740,784	D6V	probably damaging	Het
2310057M21Rik	G	T	7: 131,357,613	H165Q	probably damaging	Het
Akap6	A	T	12: 53,140,354	D1517V	probably damaging	Het
Amigo3	T	A	9: 108,053,728	S117T	probably damaging	Het
Atf7ip2	T	A	16: 10,201,411	N34K	probably damaging	Het
Cacnb1	A	C	11: 98,005,782	V351G	probably damaging	Het
Casp9	T	A	4: 141,805,349		probably null	Het
Ccdc51	C	T	9: 109,089,415	T24I	probably benign	Het
Cdh23	T	A	10: 60,434,512	Y618F	probably damaging	Het
Chd1	T	A	17: 15,758,688	W1271R	probably damaging	Het
Dars	T	C	1: 128,368,439	T386A	probably benign	Het
Dchs1	T	A	7: 105,765,106	D834V	probably damaging	Het
Dgkd	T	A	1: 87,936,381	V933E	possibly damaging	Het
Dnah17	A	G	11: 118,025,654	F4203S	probably damaging	Het
Fancm	T	C	12: 65,130,382	L2000P	probably damaging	Het
Fbxo11	A	T	17: 88,008,669	H444Q	probably benign	Het
Fbxw14	T	A	9: 109,276,222	T292S	probably damaging	Het
Fer1l6	T	C	15: 58,559,206	S237P	probably damaging	Het
Frem3	T	C	8: 80,615,047	I1323T	probably benign	Het
Grin2a	A	G	16: 9,653,449	F652L	probably benign	Het
Grin2b	T	A	6: 135,923,458	M142L	possibly damaging	Het
Helz	A	G	11: 107,619,060	Q503R	possibly damaging	Het
Ighv5-17	A	G	12: 113,859,295	Y69H	probably benign	Het
Il17ra	A	G	6: 120,475,582	N242S	probably benign	Het
Immp1l	G	C	2: 105,964,208	G117A	probably damaging	Het
Itm2c	T	C	1: 85,894,692	V10A	probably benign	Het
Kif1b	T	C	4: 149,238,426	K679E	possibly damaging	Het
Kng1	T	C	16: 23,074,645	V256A	possibly damaging	Het
Lamc2	T	G	1: 153,166,153	R78S	possibly damaging	Het
Loxl4	A	G	19: 42,598,793	F621S	probably damaging	Het
Lpl	T	A	8: 68,892,747	D134E	probably damaging	Het
Lypd3	T	C	7: 24,640,494	Y329H	probably benign	Het
Mettl13	T	C	1: 162,535,886	D225G	probably benign	Het
Myo7b	A	G	18: 31,999,974	F441L	probably damaging	Het
Nnt	T	A	13: 119,336,328	M699L	possibly damaging	Het
Nr1h3	A	T	2: 91,191,851	M144K	probably damaging	Het
Olfr1040	A	G	2: 86,145,969	V255A	probably benign	Het
Olfr1347	T	C	7: 6,488,845	T3A	probably benign	Het
Olfr325	A	T	11: 58,581,068	M75L	probably benign	Het
Pappa2	A	T	1: 158,871,543	Y667N	probably damaging	Het
Prps1l3	A	G	12: 57,238,888	I155V	probably benign	Het
Ptgs2	T	A	1: 150,100,993	N24K	probably benign	Het
Ralgds	A	T	2: 28,547,588	M514L	probably damaging	Het
Rbm47	G	C	5: 66,026,283	R326G	probably damaging	Het
Sacm1l	T	A	9: 123,569,005	V254D	probably damaging	Het
Selenot	A	T	3: 58,585,284	Q64L	probably damaging	Het
Sgsm2	G	A	11: 74,850,851	R1037W	probably damaging	Het
Slc22a12	A	G	19: 6,542,724	V10A	probably benign	Het
Spem2	G	T	11: 69,816,696	S481*	probably null	Het
Styk1	C	T	6: 131,311,016	G128D	probably damaging	Het
Tmc6	A	T	11: 117,776,328	L148Q	probably damaging	Het
Tmem138	A	C	19: 10,574,835		probably null	Het
Tnpo3	A	G	6: 29,555,268	V772A	probably benign	Het
Topaz1	T	C	9: 122,797,756	F1483S	possibly damaging	Het
Tuba4a	C	A	1: 75,216,055	C305F	probably damaging	Het
Ubap1	T	G	4: 41,379,262	F159V	possibly damaging	Het
Vmn2r9	A	G	5: 108,849,016	I129T	probably benign	Het
Wwc2	A	T	8: 47,856,263	M828K	unknown	Het
Zfp236	A	T	18: 82,671,794	S187T	possibly damaging	Het

Other mutations in Akap13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Akap13	APN	7	75725971	missense	probably damaging	0.99
IGL00332:Akap13	APN	7	75728919	missense	probably damaging	1.00
IGL00481:Akap13	APN	7	75723895	missense	probably damaging	1.00
IGL00590:Akap13	APN	7	75610669	missense	probably benign	0.01
IGL00655:Akap13	APN	7	75704398	missense	probably damaging	0.99
IGL00766:Akap13	APN	7	75704512	missense	probably damaging	0.96
IGL00818:Akap13	APN	7	75609727	missense	probably benign	0.00
IGL00826:Akap13	APN	7	75677447	missense	probably damaging	1.00
IGL01014:Akap13	APN	7	75750633	utr 3 prime	probably benign
IGL01090:Akap13	APN	7	75666531	missense	probably benign	0.44
IGL01155:Akap13	APN	7	75569936	missense	probably damaging	1.00
IGL01326:Akap13	APN	7	75725348	missense	probably benign	0.30
IGL01456:Akap13	APN	7	75602847	missense	probably damaging	0.98
IGL01460:Akap13	APN	7	75747846	missense	probably benign	0.29
IGL01568:Akap13	APN	7	75608522	nonsense	probably null	0.00
IGL01610:Akap13	APN	7	75720180	missense	possibly damaging	0.71
IGL01610:Akap13	APN	7	75747605	missense	probably damaging	1.00
IGL01615:Akap13	APN	7	75697393	missense	probably damaging	1.00
IGL01667:Akap13	APN	7	75570019	missense	probably damaging	1.00
IGL01705:Akap13	APN	7	75746767	missense	possibly damaging	0.86
IGL02070:Akap13	APN	7	75666545	missense	probably benign	0.27
IGL02269:Akap13	APN	7	75602911	missense	probably benign
IGL02421:Akap13	APN	7	75717806	missense	possibly damaging	0.66
IGL02870:Akap13	APN	7	75609188	missense	probably damaging	0.96
IGL02944:Akap13	APN	7	75608657	missense	probably benign
IGL03051:Akap13	APN	7	75610485	nonsense	probably null
IGL03160:Akap13	APN	7	75730417	missense	probably damaging	1.00
IGL03245:Akap13	APN	7	75609752	missense	probably damaging	0.99
R0254:Akap13	UTSW	7	75736604	splice site	probably benign
R0310:Akap13	UTSW	7	75614930	missense	probably damaging	0.99
R0373:Akap13	UTSW	7	75609929	missense	probably benign	0.00
R0373:Akap13	UTSW	7	75730500	missense	probably damaging	1.00
R0408:Akap13	UTSW	7	75746796	missense	probably damaging	1.00
R0631:Akap13	UTSW	7	75614996	missense	probably damaging	0.99
R0646:Akap13	UTSW	7	75747746	missense	probably damaging	1.00
R0781:Akap13	UTSW	7	75611377	missense	possibly damaging	0.56
R0845:Akap13	UTSW	7	75725380	missense	probably damaging	1.00
R1004:Akap13	UTSW	7	75687286	missense	probably damaging	0.99
R1024:Akap13	UTSW	7	75677409	missense	probably damaging	1.00
R1110:Akap13	UTSW	7	75611377	missense	possibly damaging	0.56
R1346:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1349:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1372:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1387:Akap13	UTSW	7	75586193	missense	probably damaging	0.97
R1442:Akap13	UTSW	7	75735778	missense	probably damaging	0.99
R1466:Akap13	UTSW	7	75729049	missense	possibly damaging	0.79
R1466:Akap13	UTSW	7	75729049	missense	possibly damaging	0.79
R1584:Akap13	UTSW	7	75729049	missense	possibly damaging	0.79
R1696:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1738:Akap13	UTSW	7	75677194	missense	probably damaging	1.00
R1773:Akap13	UTSW	7	75683451	missense	possibly damaging	0.80
R1785:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R1786:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R1791:Akap13	UTSW	7	75611035	missense	probably benign	0.00
R1819:Akap13	UTSW	7	75608705	missense	probably benign	0.04
R1879:Akap13	UTSW	7	75610727	missense	probably benign	0.01
R1989:Akap13	UTSW	7	75704516	missense	probably benign	0.01
R2016:Akap13	UTSW	7	75704531	missense	probably damaging	0.99
R2092:Akap13	UTSW	7	75610570	missense	probably benign	0.05
R2126:Akap13	UTSW	7	75725304	missense	possibly damaging	0.95
R2131:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R2132:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R2133:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R2251:Akap13	UTSW	7	75739477	missense	possibly damaging	0.50
R3704:Akap13	UTSW	7	75666550	missense	probably damaging	1.00
R3713:Akap13	UTSW	7	75586181	missense	probably damaging	0.98
R3731:Akap13	UTSW	7	75611377	missense	probably benign	0.39
R3765:Akap13	UTSW	7	75608837	missense	probably benign	0.04
R3788:Akap13	UTSW	7	75702153	critical splice donor site	probably null
R3793:Akap13	UTSW	7	75610141	missense	probably benign	0.00
R3970:Akap13	UTSW	7	75569951	nonsense	probably null
R4205:Akap13	UTSW	7	75610919	missense	probably benign	0.05
R4257:Akap13	UTSW	7	75611285	missense	probably damaging	0.98
R4374:Akap13	UTSW	7	75608984	missense	probably damaging	0.96
R4448:Akap13	UTSW	7	75742760	missense	probably damaging	1.00
R4450:Akap13	UTSW	7	75742760	missense	probably damaging	1.00
R4457:Akap13	UTSW	7	75739465	missense	probably damaging	0.99
R4458:Akap13	UTSW	7	75739465	missense	probably damaging	0.99
R4466:Akap13	UTSW	7	75602773	splice site	probably null
R4632:Akap13	UTSW	7	75666553	missense	possibly damaging	0.91
R4667:Akap13	UTSW	7	75729094	missense	probably damaging	1.00
R4669:Akap13	UTSW	7	75729094	missense	probably damaging	1.00
R4671:Akap13	UTSW	7	75579564	nonsense	probably null
R4821:Akap13	UTSW	7	75677507	intron	probably benign
R4868:Akap13	UTSW	7	75743504	missense	probably damaging	1.00
R4894:Akap13	UTSW	7	75725320	missense	possibly damaging	0.76
R4943:Akap13	UTSW	7	75749240	missense	probably benign	0.22
R4962:Akap13	UTSW	7	75749430	missense	probably damaging	0.98
R4988:Akap13	UTSW	7	75730528	missense	probably damaging	1.00
R5119:Akap13	UTSW	7	75687252	missense	probably damaging	0.98
R5141:Akap13	UTSW	7	75609614	missense	probably benign	0.18
R5419:Akap13	UTSW	7	75610243	missense	probably benign	0.01
R5427:Akap13	UTSW	7	75728869	missense	possibly damaging	0.89
R5429:Akap13	UTSW	7	75602904	missense	possibly damaging	0.70
R5432:Akap13	UTSW	7	75602830	missense	probably damaging	1.00
R5458:Akap13	UTSW	7	75586301	missense	probably damaging	1.00
R5636:Akap13	UTSW	7	75704372	missense	probably damaging	0.96
R5643:Akap13	UTSW	7	75702154	critical splice donor site	probably null
R5898:Akap13	UTSW	7	75729146	missense	probably damaging	1.00
R5932:Akap13	UTSW	7	75610184	missense	probably damaging	1.00
R6135:Akap13	UTSW	7	75609908	missense	possibly damaging	0.94
R6182:Akap13	UTSW	7	75586280	missense	probably benign	0.45
R6310:Akap13	UTSW	7	75749193	missense	probably damaging	0.99
R6346:Akap13	UTSW	7	75685254	missense	probably damaging	1.00
R6466:Akap13	UTSW	7	75727044	missense	probably benign	0.01
R6605:Akap13	UTSW	7	75579768	missense	probably damaging	0.98
R6617:Akap13	UTSW	7	75730363	missense	possibly damaging	0.95
R6621:Akap13	UTSW	7	75569981	missense	probably damaging	1.00
R6703:Akap13	UTSW	7	75602898	missense	probably damaging	1.00
R6750:Akap13	UTSW	7	75739458	missense	probably benign	0.03
R7069:Akap13	UTSW	7	75610262	missense	probably benign	0.29
R7116:Akap13	UTSW	7	75720195	missense	probably benign	0.00
R7158:Akap13	UTSW	7	75579594	missense	probably damaging	0.97
R7159:Akap13	UTSW	7	75730579	missense	possibly damaging	0.72
R7467:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7468:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7471:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7472:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7477:Akap13	UTSW	7	75749247	missense	probably benign
R7636:Akap13	UTSW	7	75609873	missense	probably benign	0.04
R7650:Akap13	UTSW	7	75643454	missense	probably benign	0.20
R7671:Akap13	UTSW	7	75569900	missense	probably damaging	1.00
R7681:Akap13	UTSW	7	75728796	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- GTCCCTTCCTCAGACTTCAAAG -3'
(R):5'- GGGTTACCTTTCTTCTACCATAGTG -3'

Sequencing Primer
(F):5'- CTTCCTCAGACTTCAAAGTTAAACAG -3'
(R):5'- CGAGTTATGGAATGCACAG -3'

Posted On

2017-10-10