Incidental Mutation 'R6137:Amigo3'
ID488407
Institutional Source Beutler Lab
Gene Symbol Amigo3
Ensembl Gene ENSMUSG00000032593
Gene Nameadhesion molecule with Ig like domain 3
SynonymsE430002N15Rik
MMRRC Submission 044284-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6137 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location108053159-108055701 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108053728 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 117 (S117T)
Ref Sequence ENSEMBL: ENSMUSP00000082137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035214] [ENSMUST00000047746] [ENSMUST00000047947] [ENSMUST00000085060] [ENSMUST00000112295] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000162355] [ENSMUST00000162753] [ENSMUST00000178267]
Predicted Effect probably benign
Transcript: ENSMUST00000035214
SMART Domains Protein: ENSMUSP00000035214
Gene: ENSMUSG00000032594

DomainStartEndE-ValueType
low complexity region 114 129 N/A INTRINSIC
Pfam:IPK 207 426 2.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047746
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047947
SMART Domains Protein: ENSMUSP00000036898
Gene: ENSMUSG00000070284

DomainStartEndE-ValueType
Pfam:NTP_transferase 2 234 8e-48 PFAM
Pfam:NTP_transf_3 3 202 6.6e-12 PFAM
Pfam:Hexapep 259 294 1.8e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000085060
AA Change: S117T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082137
Gene: ENSMUSG00000032593
AA Change: S117T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 33 65 2.55e-2 SMART
LRR 65 83 6.97e1 SMART
LRR_TYP 84 107 1.56e-2 SMART
LRR 109 131 2.84e1 SMART
LRR 132 155 7.05e-1 SMART
LRR 156 176 3.98e1 SMART
LRR 182 206 5.56e0 SMART
Blast:LRRCT 219 274 8e-23 BLAST
IG 285 372 1.59e-6 SMART
transmembrane domain 383 405 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
low complexity region 492 504 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112295
SMART Domains Protein: ENSMUSP00000107914
Gene: ENSMUSG00000070284

DomainStartEndE-ValueType
Pfam:NTP_transferase 2 235 2.1e-51 PFAM
Pfam:NTP_transf_3 3 199 1.1e-11 PFAM
Pfam:Hexapep 259 294 9.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159136
Predicted Effect probably benign
Transcript: ENSMUST00000159306
SMART Domains Protein: ENSMUSP00000125695
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
coiled coil region 172 192 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159526
Predicted Effect probably benign
Transcript: ENSMUST00000160249
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160649
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162123
Predicted Effect probably benign
Transcript: ENSMUST00000162355
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173683
Predicted Effect probably benign
Transcript: ENSMUST00000162753
Predicted Effect probably benign
Transcript: ENSMUST00000178267
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Meta Mutation Damage Score 0.5380 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A T 19: 8,740,784 D6V probably damaging Het
2310057M21Rik G T 7: 131,357,613 H165Q probably damaging Het
Akap13 T A 7: 75,677,416 F721Y probably damaging Het
Akap6 A T 12: 53,140,354 D1517V probably damaging Het
Atf7ip2 T A 16: 10,201,411 N34K probably damaging Het
Cacnb1 A C 11: 98,005,782 V351G probably damaging Het
Casp9 T A 4: 141,805,349 probably null Het
Ccdc51 C T 9: 109,089,415 T24I probably benign Het
Cdh23 T A 10: 60,434,512 Y618F probably damaging Het
Chd1 T A 17: 15,758,688 W1271R probably damaging Het
Dars T C 1: 128,368,439 T386A probably benign Het
Dchs1 T A 7: 105,765,106 D834V probably damaging Het
Dgkd T A 1: 87,936,381 V933E possibly damaging Het
Dnah17 A G 11: 118,025,654 F4203S probably damaging Het
Fancm T C 12: 65,130,382 L2000P probably damaging Het
Fbxo11 A T 17: 88,008,669 H444Q probably benign Het
Fbxw14 T A 9: 109,276,222 T292S probably damaging Het
Fer1l6 T C 15: 58,559,206 S237P probably damaging Het
Frem3 T C 8: 80,615,047 I1323T probably benign Het
Grin2a A G 16: 9,653,449 F652L probably benign Het
Grin2b T A 6: 135,923,458 M142L possibly damaging Het
Helz A G 11: 107,619,060 Q503R possibly damaging Het
Ighv5-17 A G 12: 113,859,295 Y69H probably benign Het
Il17ra A G 6: 120,475,582 N242S probably benign Het
Immp1l G C 2: 105,964,208 G117A probably damaging Het
Itm2c T C 1: 85,894,692 V10A probably benign Het
Kif1b T C 4: 149,238,426 K679E possibly damaging Het
Kng1 T C 16: 23,074,645 V256A possibly damaging Het
Lamc2 T G 1: 153,166,153 R78S possibly damaging Het
Loxl4 A G 19: 42,598,793 F621S probably damaging Het
Lpl T A 8: 68,892,747 D134E probably damaging Het
Lypd3 T C 7: 24,640,494 Y329H probably benign Het
Mettl13 T C 1: 162,535,886 D225G probably benign Het
Myo7b A G 18: 31,999,974 F441L probably damaging Het
Nnt T A 13: 119,336,328 M699L possibly damaging Het
Nr1h3 A T 2: 91,191,851 M144K probably damaging Het
Olfr1040 A G 2: 86,145,969 V255A probably benign Het
Olfr1347 T C 7: 6,488,845 T3A probably benign Het
Olfr325 A T 11: 58,581,068 M75L probably benign Het
Pappa2 A T 1: 158,871,543 Y667N probably damaging Het
Prps1l3 A G 12: 57,238,888 I155V probably benign Het
Ptgs2 T A 1: 150,100,993 N24K probably benign Het
Ralgds A T 2: 28,547,588 M514L probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Sacm1l T A 9: 123,569,005 V254D probably damaging Het
Selenot A T 3: 58,585,284 Q64L probably damaging Het
Sgsm2 G A 11: 74,850,851 R1037W probably damaging Het
Slc22a12 A G 19: 6,542,724 V10A probably benign Het
Spem2 G T 11: 69,816,696 S481* probably null Het
Styk1 C T 6: 131,311,016 G128D probably damaging Het
Tmc6 A T 11: 117,776,328 L148Q probably damaging Het
Tmem138 A C 19: 10,574,835 probably null Het
Tnpo3 A G 6: 29,555,268 V772A probably benign Het
Topaz1 T C 9: 122,797,756 F1483S possibly damaging Het
Tuba4a C A 1: 75,216,055 C305F probably damaging Het
Ubap1 T G 4: 41,379,262 F159V possibly damaging Het
Vmn2r9 A G 5: 108,849,016 I129T probably benign Het
Wwc2 A T 8: 47,856,263 M828K unknown Het
Zfp236 A T 18: 82,671,794 S187T possibly damaging Het
Other mutations in Amigo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Amigo3 APN 9 108053402 missense possibly damaging 0.93
R0047:Amigo3 UTSW 9 108054658 missense probably benign
R0047:Amigo3 UTSW 9 108054658 missense probably benign
R1079:Amigo3 UTSW 9 108053852 missense probably benign 0.00
R1585:Amigo3 UTSW 9 108054032 missense probably damaging 1.00
R1907:Amigo3 UTSW 9 108053636 missense probably benign 0.10
R2899:Amigo3 UTSW 9 108054154 missense probably benign 0.42
R4770:Amigo3 UTSW 9 108053535 missense probably damaging 0.97
R5188:Amigo3 UTSW 9 108054683 missense probably damaging 0.99
R6781:Amigo3 UTSW 9 108053963 missense probably damaging 1.00
R7326:Amigo3 UTSW 9 108054066 missense probably benign 0.00
R7773:Amigo3 UTSW 9 108054668 missense probably benign 0.01
R8672:Amigo3 UTSW 9 108054176 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TACCACTGCTGCAGAACTC -3'
(R):5'- GTTTCAGCCAGTTGGAGGAG -3'

Sequencing Primer
(F):5'- CACTGCTGCAGAACTCGATTTGAG -3'
(R):5'- CAGACCGTGCAAGTGGTTG -3'
Posted On2017-10-10