Incidental Mutation 'R6137:Fbxw14'
ID488409
Institutional Source Beutler Lab
Gene Symbol Fbxw14
Ensembl Gene ENSMUSG00000105589
Gene NameF-box and WD-40 domain protein 14
SynonymsE330009N23Rik, Fbxo12, Fbx12
MMRRC Submission 044284-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R6137 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location109270790-109287676 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109276222 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 292 (T292S)
Ref Sequence ENSEMBL: ENSMUSP00000143404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112041] [ENSMUST00000198048] [ENSMUST00000198844]
Predicted Effect probably damaging
Transcript: ENSMUST00000112041
AA Change: T239S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107672
Gene: ENSMUSG00000105589
AA Change: T239S

DomainStartEndE-ValueType
FBOX 5 45 3.13e-6 SMART
SCOP:d1tbga_ 114 208 2e-3 SMART
Blast:WD40 136 175 4e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000198048
Predicted Effect probably damaging
Transcript: ENSMUST00000198844
AA Change: T292S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143404
Gene: ENSMUSG00000105589
AA Change: T292S

DomainStartEndE-ValueType
FBOX 5 45 3.13e-6 SMART
SCOP:d1tbga_ 114 249 4e-9 SMART
Blast:WD40 136 175 3e-6 BLAST
Meta Mutation Damage Score 0.1670 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A T 19: 8,740,784 D6V probably damaging Het
2310057M21Rik G T 7: 131,357,613 H165Q probably damaging Het
Akap13 T A 7: 75,677,416 F721Y probably damaging Het
Akap6 A T 12: 53,140,354 D1517V probably damaging Het
Amigo3 T A 9: 108,053,728 S117T probably damaging Het
Atf7ip2 T A 16: 10,201,411 N34K probably damaging Het
Cacnb1 A C 11: 98,005,782 V351G probably damaging Het
Casp9 T A 4: 141,805,349 probably null Het
Ccdc51 C T 9: 109,089,415 T24I probably benign Het
Cdh23 T A 10: 60,434,512 Y618F probably damaging Het
Chd1 T A 17: 15,758,688 W1271R probably damaging Het
Dars T C 1: 128,368,439 T386A probably benign Het
Dchs1 T A 7: 105,765,106 D834V probably damaging Het
Dgkd T A 1: 87,936,381 V933E possibly damaging Het
Dnah17 A G 11: 118,025,654 F4203S probably damaging Het
Fancm T C 12: 65,130,382 L2000P probably damaging Het
Fbxo11 A T 17: 88,008,669 H444Q probably benign Het
Fer1l6 T C 15: 58,559,206 S237P probably damaging Het
Frem3 T C 8: 80,615,047 I1323T probably benign Het
Grin2a A G 16: 9,653,449 F652L probably benign Het
Grin2b T A 6: 135,923,458 M142L possibly damaging Het
Helz A G 11: 107,619,060 Q503R possibly damaging Het
Ighv5-17 A G 12: 113,859,295 Y69H probably benign Het
Il17ra A G 6: 120,475,582 N242S probably benign Het
Immp1l G C 2: 105,964,208 G117A probably damaging Het
Itm2c T C 1: 85,894,692 V10A probably benign Het
Kif1b T C 4: 149,238,426 K679E possibly damaging Het
Kng1 T C 16: 23,074,645 V256A possibly damaging Het
Lamc2 T G 1: 153,166,153 R78S possibly damaging Het
Loxl4 A G 19: 42,598,793 F621S probably damaging Het
Lpl T A 8: 68,892,747 D134E probably damaging Het
Lypd3 T C 7: 24,640,494 Y329H probably benign Het
Mettl13 T C 1: 162,535,886 D225G probably benign Het
Myo7b A G 18: 31,999,974 F441L probably damaging Het
Nnt T A 13: 119,336,328 M699L possibly damaging Het
Nr1h3 A T 2: 91,191,851 M144K probably damaging Het
Olfr1040 A G 2: 86,145,969 V255A probably benign Het
Olfr1347 T C 7: 6,488,845 T3A probably benign Het
Olfr325 A T 11: 58,581,068 M75L probably benign Het
Pappa2 A T 1: 158,871,543 Y667N probably damaging Het
Prps1l3 A G 12: 57,238,888 I155V probably benign Het
Ptgs2 T A 1: 150,100,993 N24K probably benign Het
Ralgds A T 2: 28,547,588 M514L probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Sacm1l T A 9: 123,569,005 V254D probably damaging Het
Selenot A T 3: 58,585,284 Q64L probably damaging Het
Sgsm2 G A 11: 74,850,851 R1037W probably damaging Het
Slc22a12 A G 19: 6,542,724 V10A probably benign Het
Spem2 G T 11: 69,816,696 S481* probably null Het
Styk1 C T 6: 131,311,016 G128D probably damaging Het
Tmc6 A T 11: 117,776,328 L148Q probably damaging Het
Tmem138 A C 19: 10,574,835 probably null Het
Tnpo3 A G 6: 29,555,268 V772A probably benign Het
Topaz1 T C 9: 122,797,756 F1483S possibly damaging Het
Tuba4a C A 1: 75,216,055 C305F probably damaging Het
Ubap1 T G 4: 41,379,262 F159V possibly damaging Het
Vmn2r9 A G 5: 108,849,016 I129T probably benign Het
Wwc2 A T 8: 47,856,263 M828K unknown Het
Zfp236 A T 18: 82,671,794 S187T possibly damaging Het
Other mutations in Fbxw14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Fbxw14 APN 9 109278791 missense probably damaging 1.00
IGL01351:Fbxw14 APN 9 109274572 missense possibly damaging 0.47
IGL01654:Fbxw14 APN 9 109286580 splice site probably benign
K3955:Fbxw14 UTSW 9 109276245 missense possibly damaging 0.87
R0064:Fbxw14 UTSW 9 109287592 nonsense probably null
R0133:Fbxw14 UTSW 9 109274579 missense probably benign 0.02
R0975:Fbxw14 UTSW 9 109271239 missense probably benign 0.00
R1124:Fbxw14 UTSW 9 109276168 missense possibly damaging 0.48
R1782:Fbxw14 UTSW 9 109278691 missense possibly damaging 0.94
R2118:Fbxw14 UTSW 9 109274624 splice site probably benign
R3881:Fbxw14 UTSW 9 109271194 missense possibly damaging 0.95
R4641:Fbxw14 UTSW 9 109278682 critical splice donor site probably null
R4915:Fbxw14 UTSW 9 109274524 missense possibly damaging 0.82
R4952:Fbxw14 UTSW 9 109276201 missense probably benign 0.01
R6187:Fbxw14 UTSW 9 109276264 missense probably damaging 1.00
R6584:Fbxw14 UTSW 9 109286543 missense possibly damaging 0.85
R7130:Fbxw14 UTSW 9 109271282 missense probably benign 0.02
R7845:Fbxw14 UTSW 9 109287603 missense probably damaging 1.00
R8049:Fbxw14 UTSW 9 109276143 missense probably damaging 0.98
R8169:Fbxw14 UTSW 9 109277216 missense probably benign 0.05
R8815:Fbxw14 UTSW 9 109276237 nonsense probably null
R8816:Fbxw14 UTSW 9 109276237 nonsense probably null
R8818:Fbxw14 UTSW 9 109287003 start gained probably benign
X0067:Fbxw14 UTSW 9 109276201 missense probably benign 0.01
Z1177:Fbxw14 UTSW 9 109276246 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAGTCTCCTGATTTTGGGGC -3'
(R):5'- CTGTCCTGGGTGAAGAACAG -3'

Sequencing Primer
(F):5'- CCTGATTTTGGGGCGTATGACATC -3'
(R):5'- GTGAAGAACAGATGCAACCACTCTTG -3'
Posted On2017-10-10