Incidental Mutation 'R6137:Spem2'
ID488414
Institutional Source Beutler Lab
Gene Symbol Spem2
Ensembl Gene ENSMUSG00000044084
Gene NameSPEM family member 2
Synonyms4933402P03Rik
MMRRC Submission 044284-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R6137 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location69816566-69818465 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 69816696 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 481 (S481*)
Ref Sequence ENSEMBL: ENSMUSP00000051204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045771] [ENSMUST00000056941] [ENSMUST00000210714]
Predicted Effect probably benign
Transcript: ENSMUST00000045771
SMART Domains Protein: ENSMUSP00000037500
Gene: ENSMUSG00000041165

DomainStartEndE-ValueType
Pfam:Spem1 12 196 3.7e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000056941
AA Change: S481*
SMART Domains Protein: ENSMUSP00000051204
Gene: ENSMUSG00000044084
AA Change: S481*

DomainStartEndE-ValueType
Pfam:Spem1 1 261 2e-121 PFAM
low complexity region 281 294 N/A INTRINSIC
low complexity region 478 494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210714
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A T 19: 8,740,784 D6V probably damaging Het
2310057M21Rik G T 7: 131,357,613 H165Q probably damaging Het
Akap13 T A 7: 75,677,416 F721Y probably damaging Het
Akap6 A T 12: 53,140,354 D1517V probably damaging Het
Amigo3 T A 9: 108,053,728 S117T probably damaging Het
Atf7ip2 T A 16: 10,201,411 N34K probably damaging Het
Cacnb1 A C 11: 98,005,782 V351G probably damaging Het
Casp9 T A 4: 141,805,349 probably null Het
Ccdc51 C T 9: 109,089,415 T24I probably benign Het
Cdh23 T A 10: 60,434,512 Y618F probably damaging Het
Chd1 T A 17: 15,758,688 W1271R probably damaging Het
Dars T C 1: 128,368,439 T386A probably benign Het
Dchs1 T A 7: 105,765,106 D834V probably damaging Het
Dgkd T A 1: 87,936,381 V933E possibly damaging Het
Dnah17 A G 11: 118,025,654 F4203S probably damaging Het
Fancm T C 12: 65,130,382 L2000P probably damaging Het
Fbxo11 A T 17: 88,008,669 H444Q probably benign Het
Fbxw14 T A 9: 109,276,222 T292S probably damaging Het
Fer1l6 T C 15: 58,559,206 S237P probably damaging Het
Frem3 T C 8: 80,615,047 I1323T probably benign Het
Grin2a A G 16: 9,653,449 F652L probably benign Het
Grin2b T A 6: 135,923,458 M142L possibly damaging Het
Helz A G 11: 107,619,060 Q503R possibly damaging Het
Ighv5-17 A G 12: 113,859,295 Y69H probably benign Het
Il17ra A G 6: 120,475,582 N242S probably benign Het
Immp1l G C 2: 105,964,208 G117A probably damaging Het
Itm2c T C 1: 85,894,692 V10A probably benign Het
Kif1b T C 4: 149,238,426 K679E possibly damaging Het
Kng1 T C 16: 23,074,645 V256A possibly damaging Het
Lamc2 T G 1: 153,166,153 R78S possibly damaging Het
Loxl4 A G 19: 42,598,793 F621S probably damaging Het
Lpl T A 8: 68,892,747 D134E probably damaging Het
Lypd3 T C 7: 24,640,494 Y329H probably benign Het
Mettl13 T C 1: 162,535,886 D225G probably benign Het
Myo7b A G 18: 31,999,974 F441L probably damaging Het
Nnt T A 13: 119,336,328 M699L possibly damaging Het
Nr1h3 A T 2: 91,191,851 M144K probably damaging Het
Olfr1040 A G 2: 86,145,969 V255A probably benign Het
Olfr1347 T C 7: 6,488,845 T3A probably benign Het
Olfr325 A T 11: 58,581,068 M75L probably benign Het
Pappa2 A T 1: 158,871,543 Y667N probably damaging Het
Prps1l3 A G 12: 57,238,888 I155V probably benign Het
Ptgs2 T A 1: 150,100,993 N24K probably benign Het
Ralgds A T 2: 28,547,588 M514L probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Sacm1l T A 9: 123,569,005 V254D probably damaging Het
Selenot A T 3: 58,585,284 Q64L probably damaging Het
Sgsm2 G A 11: 74,850,851 R1037W probably damaging Het
Slc22a12 A G 19: 6,542,724 V10A probably benign Het
Styk1 C T 6: 131,311,016 G128D probably damaging Het
Tmc6 A T 11: 117,776,328 L148Q probably damaging Het
Tmem138 A C 19: 10,574,835 probably null Het
Tnpo3 A G 6: 29,555,268 V772A probably benign Het
Topaz1 T C 9: 122,797,756 F1483S possibly damaging Het
Tuba4a C A 1: 75,216,055 C305F probably damaging Het
Ubap1 T G 4: 41,379,262 F159V possibly damaging Het
Vmn2r9 A G 5: 108,849,016 I129T probably benign Het
Wwc2 A T 8: 47,856,263 M828K unknown Het
Zfp236 A T 18: 82,671,794 S187T possibly damaging Het
Other mutations in Spem2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Spem2 APN 11 69817239 missense possibly damaging 0.53
IGL02208:Spem2 APN 11 69817263 splice site probably null
IGL02315:Spem2 APN 11 69817365 missense probably damaging 0.98
IGL02325:Spem2 APN 11 69816963 missense probably benign 0.00
IGL02877:Spem2 APN 11 69817695 missense probably benign 0.16
R1476:Spem2 UTSW 11 69818070 missense probably benign 0.05
R1928:Spem2 UTSW 11 69817464 missense probably benign 0.03
R3741:Spem2 UTSW 11 69816730 missense possibly damaging 0.53
R3811:Spem2 UTSW 11 69817164 missense possibly damaging 0.72
R4271:Spem2 UTSW 11 69817425 missense probably damaging 0.98
R4717:Spem2 UTSW 11 69817783 missense probably benign 0.37
R4997:Spem2 UTSW 11 69817732 missense probably benign 0.06
R5114:Spem2 UTSW 11 69817147 missense probably benign 0.33
R6302:Spem2 UTSW 11 69818265 missense possibly damaging 0.71
R6454:Spem2 UTSW 11 69817428 missense probably damaging 0.97
R6923:Spem2 UTSW 11 69817777 missense probably damaging 0.99
R7000:Spem2 UTSW 11 69817756 missense probably benign
R8516:Spem2 UTSW 11 69816895 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AATCCCAGGTCAGTGAAAGG -3'
(R):5'- GGTGAGGCTTCATACCAAAGG -3'

Sequencing Primer
(F):5'- CCCAGGTCAGTGAAAGGAGAGATTC -3'
(R):5'- AGCTCGGGCCTGATGATC -3'
Posted On2017-10-10