Incidental Mutation 'R6137:Cacnb1'
ID488416
Institutional Source Beutler Lab
Gene Symbol Cacnb1
Ensembl Gene ENSMUSG00000020882
Gene Namecalcium channel, voltage-dependent, beta 1 subunit
SynonymsCchb1, Cchlb1
MMRRC Submission 044284-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6137 (G1)
Quality Score200.009
Status Validated
Chromosome11
Chromosomal Location98001508-98023034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 98005782 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 351 (V351G)
Ref Sequence ENSEMBL: ENSMUSP00000103187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017552] [ENSMUST00000092736] [ENSMUST00000103144] [ENSMUST00000107561] [ENSMUST00000107562]
Predicted Effect probably damaging
Transcript: ENSMUST00000017552
AA Change: V351G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000017552
Gene: ENSMUSG00000020882
AA Change: V351G

DomainStartEndE-ValueType
low complexity region 41 53 N/A INTRINSIC
Pfam:VGCC_beta4Aa_N 58 99 1.1e-26 PFAM
SH3 103 167 2.98e-2 SMART
low complexity region 182 193 N/A INTRINSIC
GuKc 228 409 5.57e-41 SMART
low complexity region 412 443 N/A INTRINSIC
low complexity region 523 543 N/A INTRINSIC
low complexity region 549 557 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092736
AA Change: V396G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090412
Gene: ENSMUSG00000020882
AA Change: V396G

DomainStartEndE-ValueType
low complexity region 41 53 N/A INTRINSIC
Pfam:VGCC_beta4Aa_N 58 99 4.7e-26 PFAM
SH3 103 167 2.98e-2 SMART
low complexity region 182 193 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
GuKc 273 454 5.57e-41 SMART
low complexity region 457 488 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103144
AA Change: V396G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099433
Gene: ENSMUSG00000020882
AA Change: V396G

DomainStartEndE-ValueType
low complexity region 41 53 N/A INTRINSIC
Pfam:VGCC_beta4Aa_N 58 99 1.4e-25 PFAM
SH3 103 167 2.98e-2 SMART
low complexity region 182 193 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
GuKc 273 454 5.57e-41 SMART
low complexity region 457 488 N/A INTRINSIC
low complexity region 603 623 N/A INTRINSIC
low complexity region 629 637 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107561
AA Change: V349G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103186
Gene: ENSMUSG00000020882
AA Change: V349G

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 11 52 8e-27 PFAM
SH3 56 120 2.98e-2 SMART
low complexity region 135 146 N/A INTRINSIC
low complexity region 172 187 N/A INTRINSIC
GuKc 226 407 5.57e-41 SMART
low complexity region 410 441 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107562
AA Change: V351G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103187
Gene: ENSMUSG00000020882
AA Change: V351G

DomainStartEndE-ValueType
low complexity region 41 53 N/A INTRINSIC
Pfam:VGCC_beta4Aa_N 58 99 4.2e-26 PFAM
SH3 103 167 2.98e-2 SMART
low complexity region 182 193 N/A INTRINSIC
GuKc 228 409 5.57e-41 SMART
low complexity region 412 443 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135462
Meta Mutation Damage Score 0.5078 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the calcium channel beta subunit family. It plays an important role in the calcium channel by modulating G protein inhibition, increasing peak calcium current, controlling the alpha-1 subunit membrane targeting and shifting the voltage dependence of activation and inactivation. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality. Mutant animals have reduced muscle mass, thin limbs, a curved spine, and flexed necks and extremeties. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A T 19: 8,740,784 D6V probably damaging Het
2310057M21Rik G T 7: 131,357,613 H165Q probably damaging Het
Akap13 T A 7: 75,677,416 F721Y probably damaging Het
Akap6 A T 12: 53,140,354 D1517V probably damaging Het
Amigo3 T A 9: 108,053,728 S117T probably damaging Het
Atf7ip2 T A 16: 10,201,411 N34K probably damaging Het
Casp9 T A 4: 141,805,349 probably null Het
Ccdc51 C T 9: 109,089,415 T24I probably benign Het
Cdh23 T A 10: 60,434,512 Y618F probably damaging Het
Chd1 T A 17: 15,758,688 W1271R probably damaging Het
Dars T C 1: 128,368,439 T386A probably benign Het
Dchs1 T A 7: 105,765,106 D834V probably damaging Het
Dgkd T A 1: 87,936,381 V933E possibly damaging Het
Dnah17 A G 11: 118,025,654 F4203S probably damaging Het
Fancm T C 12: 65,130,382 L2000P probably damaging Het
Fbxo11 A T 17: 88,008,669 H444Q probably benign Het
Fbxw14 T A 9: 109,276,222 T292S probably damaging Het
Fer1l6 T C 15: 58,559,206 S237P probably damaging Het
Frem3 T C 8: 80,615,047 I1323T probably benign Het
Grin2a A G 16: 9,653,449 F652L probably benign Het
Grin2b T A 6: 135,923,458 M142L possibly damaging Het
Helz A G 11: 107,619,060 Q503R possibly damaging Het
Ighv5-17 A G 12: 113,859,295 Y69H probably benign Het
Il17ra A G 6: 120,475,582 N242S probably benign Het
Immp1l G C 2: 105,964,208 G117A probably damaging Het
Itm2c T C 1: 85,894,692 V10A probably benign Het
Kif1b T C 4: 149,238,426 K679E possibly damaging Het
Kng1 T C 16: 23,074,645 V256A possibly damaging Het
Lamc2 T G 1: 153,166,153 R78S possibly damaging Het
Loxl4 A G 19: 42,598,793 F621S probably damaging Het
Lpl T A 8: 68,892,747 D134E probably damaging Het
Lypd3 T C 7: 24,640,494 Y329H probably benign Het
Mettl13 T C 1: 162,535,886 D225G probably benign Het
Myo7b A G 18: 31,999,974 F441L probably damaging Het
Nnt T A 13: 119,336,328 M699L possibly damaging Het
Nr1h3 A T 2: 91,191,851 M144K probably damaging Het
Olfr1040 A G 2: 86,145,969 V255A probably benign Het
Olfr1347 T C 7: 6,488,845 T3A probably benign Het
Olfr325 A T 11: 58,581,068 M75L probably benign Het
Pappa2 A T 1: 158,871,543 Y667N probably damaging Het
Prps1l3 A G 12: 57,238,888 I155V probably benign Het
Ptgs2 T A 1: 150,100,993 N24K probably benign Het
Ralgds A T 2: 28,547,588 M514L probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Sacm1l T A 9: 123,569,005 V254D probably damaging Het
Selenot A T 3: 58,585,284 Q64L probably damaging Het
Sgsm2 G A 11: 74,850,851 R1037W probably damaging Het
Slc22a12 A G 19: 6,542,724 V10A probably benign Het
Spem2 G T 11: 69,816,696 S481* probably null Het
Styk1 C T 6: 131,311,016 G128D probably damaging Het
Tmc6 A T 11: 117,776,328 L148Q probably damaging Het
Tmem138 A C 19: 10,574,835 probably null Het
Tnpo3 A G 6: 29,555,268 V772A probably benign Het
Topaz1 T C 9: 122,797,756 F1483S possibly damaging Het
Tuba4a C A 1: 75,216,055 C305F probably damaging Het
Ubap1 T G 4: 41,379,262 F159V possibly damaging Het
Vmn2r9 A G 5: 108,849,016 I129T probably benign Het
Wwc2 A T 8: 47,856,263 M828K unknown Het
Zfp236 A T 18: 82,671,794 S187T possibly damaging Het
Other mutations in Cacnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Cacnb1 APN 11 98022364 missense possibly damaging 0.50
IGL02633:Cacnb1 APN 11 98022373 missense probably damaging 0.98
awkward UTSW 11 98005782 missense probably damaging 1.00
R1037:Cacnb1 UTSW 11 98005017 utr 3 prime probably benign
R2101:Cacnb1 UTSW 11 98005728 missense probably damaging 1.00
R2363:Cacnb1 UTSW 11 98012846 missense possibly damaging 0.87
R4159:Cacnb1 UTSW 11 98012274 missense probably damaging 1.00
R4942:Cacnb1 UTSW 11 98002983 missense probably damaging 1.00
R5360:Cacnb1 UTSW 11 98018271 critical splice donor site probably null
R5653:Cacnb1 UTSW 11 98009279 critical splice donor site probably null
R7154:Cacnb1 UTSW 11 98005133 missense probably damaging 0.99
R7163:Cacnb1 UTSW 11 98012900 missense probably benign 0.20
R7800:Cacnb1 UTSW 11 98009295 missense possibly damaging 0.56
R7816:Cacnb1 UTSW 11 98005289 missense probably damaging 1.00
R8143:Cacnb1 UTSW 11 98003320 missense probably benign 0.00
R8336:Cacnb1 UTSW 11 98003293 missense probably benign 0.00
Z1176:Cacnb1 UTSW 11 98022555 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GCATCCCTCTTTACCCAAGG -3'
(R):5'- TAAGCCTGAGCCTTGTGTCG -3'

Sequencing Primer
(F):5'- CAAGTGCTGTCTTCCATGCAGG -3'
(R):5'- GTCGTGGACACAGAGCTTG -3'
Posted On2017-10-10