Incidental Mutation 'R6137:Fancm'
ID488422
Institutional Source Beutler Lab
Gene Symbol Fancm
Ensembl Gene ENSMUSG00000055884
Gene NameFanconi anemia, complementation group M
SynonymsD12Ertd364e, C730036B14Rik
MMRRC Submission 044284-MU
Accession Numbers

Ncbi RefSeq: NM_178912.3; MGI:2442306

Is this an essential gene? Probably essential (E-score: 0.858) question?
Stock #R6137 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location65075603-65132058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65130382 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 2000 (L2000P)
Ref Sequence ENSEMBL: ENSMUSP00000054797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052201] [ENSMUST00000058889] [ENSMUST00000222540]
Predicted Effect probably benign
Transcript: ENSMUST00000052201
SMART Domains Protein: ENSMUSP00000052109
Gene: ENSMUSG00000047534

DomainStartEndE-ValueType
low complexity region 319 332 N/A INTRINSIC
Pfam:SANTA 336 425 1.4e-27 PFAM
coiled coil region 428 448 N/A INTRINSIC
coiled coil region 645 668 N/A INTRINSIC
SANT 742 794 9.48e-6 SMART
low complexity region 874 884 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000058889
AA Change: L2000P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054797
Gene: ENSMUSG00000055884
AA Change: L2000P

DomainStartEndE-ValueType
DEXDc 75 275 5.6e-25 SMART
Blast:DEXDc 295 323 9e-6 BLAST
low complexity region 339 348 N/A INTRINSIC
HELICc 475 566 5.64e-21 SMART
Pfam:FANCM-MHF_bd 657 770 8.5e-50 PFAM
low complexity region 850 866 N/A INTRINSIC
low complexity region 974 987 N/A INTRINSIC
low complexity region 1105 1120 N/A INTRINSIC
low complexity region 1165 1178 N/A INTRINSIC
PDB:4DAY|C 1207 1238 1e-6 PDB
low complexity region 1489 1506 N/A INTRINSIC
low complexity region 1572 1586 N/A INTRINSIC
low complexity region 1669 1682 N/A INTRINSIC
ERCC4 1780 1863 2.07e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140391
Predicted Effect probably benign
Transcript: ENSMUST00000221175
Predicted Effect probably benign
Transcript: ENSMUST00000222540
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (58/59)
MGI Phenotype Strain: 4355560
Lethality: D500-D600
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group M. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female transmission, hypogonadism, premature death, and increased incidence of tumors. [provided by MGI curators]
Allele List at MGI

All alleles(39) : Targeted(4) Gene trapped(35)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A T 19: 8,740,784 D6V probably damaging Het
2310057M21Rik G T 7: 131,357,613 H165Q probably damaging Het
Akap13 T A 7: 75,677,416 F721Y probably damaging Het
Akap6 A T 12: 53,140,354 D1517V probably damaging Het
Amigo3 T A 9: 108,053,728 S117T probably damaging Het
Atf7ip2 T A 16: 10,201,411 N34K probably damaging Het
Cacnb1 A C 11: 98,005,782 V351G probably damaging Het
Casp9 T A 4: 141,805,349 probably null Het
Ccdc51 C T 9: 109,089,415 T24I probably benign Het
Cdh23 T A 10: 60,434,512 Y618F probably damaging Het
Chd1 T A 17: 15,758,688 W1271R probably damaging Het
Dars T C 1: 128,368,439 T386A probably benign Het
Dchs1 T A 7: 105,765,106 D834V probably damaging Het
Dgkd T A 1: 87,936,381 V933E possibly damaging Het
Dnah17 A G 11: 118,025,654 F4203S probably damaging Het
Fbxo11 A T 17: 88,008,669 H444Q probably benign Het
Fbxw14 T A 9: 109,276,222 T292S probably damaging Het
Fer1l6 T C 15: 58,559,206 S237P probably damaging Het
Frem3 T C 8: 80,615,047 I1323T probably benign Het
Grin2a A G 16: 9,653,449 F652L probably benign Het
Grin2b T A 6: 135,923,458 M142L possibly damaging Het
Helz A G 11: 107,619,060 Q503R possibly damaging Het
Ighv5-17 A G 12: 113,859,295 Y69H probably benign Het
Il17ra A G 6: 120,475,582 N242S probably benign Het
Immp1l G C 2: 105,964,208 G117A probably damaging Het
Itm2c T C 1: 85,894,692 V10A probably benign Het
Kif1b T C 4: 149,238,426 K679E possibly damaging Het
Kng1 T C 16: 23,074,645 V256A possibly damaging Het
Lamc2 T G 1: 153,166,153 R78S possibly damaging Het
Loxl4 A G 19: 42,598,793 F621S probably damaging Het
Lpl T A 8: 68,892,747 D134E probably damaging Het
Lypd3 T C 7: 24,640,494 Y329H probably benign Het
Mettl13 T C 1: 162,535,886 D225G probably benign Het
Myo7b A G 18: 31,999,974 F441L probably damaging Het
Nnt T A 13: 119,336,328 M699L possibly damaging Het
Nr1h3 A T 2: 91,191,851 M144K probably damaging Het
Olfr1040 A G 2: 86,145,969 V255A probably benign Het
Olfr1347 T C 7: 6,488,845 T3A probably benign Het
Olfr325 A T 11: 58,581,068 M75L probably benign Het
Pappa2 A T 1: 158,871,543 Y667N probably damaging Het
Prps1l3 A G 12: 57,238,888 I155V probably benign Het
Ptgs2 T A 1: 150,100,993 N24K probably benign Het
Ralgds A T 2: 28,547,588 M514L probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Sacm1l T A 9: 123,569,005 V254D probably damaging Het
Selenot A T 3: 58,585,284 Q64L probably damaging Het
Sgsm2 G A 11: 74,850,851 R1037W probably damaging Het
Slc22a12 A G 19: 6,542,724 V10A probably benign Het
Spem2 G T 11: 69,816,696 S481* probably null Het
Styk1 C T 6: 131,311,016 G128D probably damaging Het
Tmc6 A T 11: 117,776,328 L148Q probably damaging Het
Tmem138 A C 19: 10,574,835 probably null Het
Tnpo3 A G 6: 29,555,268 V772A probably benign Het
Topaz1 T C 9: 122,797,756 F1483S possibly damaging Het
Tuba4a C A 1: 75,216,055 C305F probably damaging Het
Ubap1 T G 4: 41,379,262 F159V possibly damaging Het
Vmn2r9 A G 5: 108,849,016 I129T probably benign Het
Wwc2 A T 8: 47,856,263 M828K unknown Het
Zfp236 A T 18: 82,671,794 S187T possibly damaging Het
Other mutations in Fancm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Fancm APN 12 65075736 missense possibly damaging 0.50
IGL00489:Fancm APN 12 65106193 missense probably benign 0.01
IGL00529:Fancm APN 12 65130417 utr 3 prime probably benign
IGL00898:Fancm APN 12 65106000 missense probably benign 0.01
IGL01805:Fancm APN 12 65113861 critical splice donor site probably null
IGL01986:Fancm APN 12 65126655 nonsense probably null
IGL02026:Fancm APN 12 65105734 missense probably benign 0.03
IGL02069:Fancm APN 12 65075911 missense probably benign 0.05
IGL02103:Fancm APN 12 65095784 missense probably benign 0.38
IGL02133:Fancm APN 12 65106475 missense probably benign 0.04
IGL02400:Fancm APN 12 65113815 missense probably damaging 1.00
IGL02478:Fancm APN 12 65077090 missense probably damaging 1.00
IGL02479:Fancm APN 12 65106485 missense probably damaging 0.98
IGL02563:Fancm APN 12 65092462 missense probably damaging 1.00
IGL02606:Fancm APN 12 65076139 missense possibly damaging 0.90
IGL02731:Fancm APN 12 65088305 missense probably benign 0.00
IGL02809:Fancm APN 12 65121667 missense possibly damaging 0.54
IGL02953:Fancm APN 12 65121966 missense probably benign 0.27
IGL03066:Fancm APN 12 65125114 nonsense probably null
IGL03073:Fancm APN 12 65101632 missense probably damaging 1.00
Fancypants UTSW 12 65106461 missense probably damaging 1.00
Mylord UTSW 12 65116423 nonsense probably null
R0041_fancm_712 UTSW 12 65106443 nonsense probably null
R7172_Fancm_370 UTSW 12 65106054 missense possibly damaging 0.95
BB005:Fancm UTSW 12 65106124 missense unknown
BB015:Fancm UTSW 12 65106124 missense unknown
PIT4131001:Fancm UTSW 12 65105422 missense probably benign 0.03
R0041:Fancm UTSW 12 65106443 nonsense probably null
R0041:Fancm UTSW 12 65106443 nonsense probably null
R0125:Fancm UTSW 12 65121956 missense possibly damaging 0.68
R0201:Fancm UTSW 12 65101632 missense probably damaging 1.00
R0360:Fancm UTSW 12 65075950 missense probably damaging 1.00
R0491:Fancm UTSW 12 65106061 missense probably benign 0.32
R0557:Fancm UTSW 12 65118442 critical splice donor site probably null
R0617:Fancm UTSW 12 65097317 nonsense probably null
R1201:Fancm UTSW 12 65106768 missense possibly damaging 0.66
R1353:Fancm UTSW 12 65088170 missense probably damaging 1.00
R1456:Fancm UTSW 12 65118351 missense possibly damaging 0.48
R1468:Fancm UTSW 12 65099293 missense probably damaging 1.00
R1468:Fancm UTSW 12 65099293 missense probably damaging 1.00
R1521:Fancm UTSW 12 65121704 missense probably benign 0.25
R1530:Fancm UTSW 12 65092490 critical splice donor site probably null
R1559:Fancm UTSW 12 65093689 missense probably benign 0.00
R1632:Fancm UTSW 12 65130331 missense probably damaging 1.00
R1681:Fancm UTSW 12 65105656 missense probably benign 0.03
R1919:Fancm UTSW 12 65105520 missense possibly damaging 0.48
R1969:Fancm UTSW 12 65101692 missense probably benign 0.09
R1971:Fancm UTSW 12 65101692 missense probably benign 0.09
R2117:Fancm UTSW 12 65077174 missense probably damaging 1.00
R2510:Fancm UTSW 12 65113770 splice site probably benign
R2909:Fancm UTSW 12 65124856 missense probably damaging 1.00
R3155:Fancm UTSW 12 65116421 missense probably benign 0.32
R3405:Fancm UTSW 12 65075772 missense probably benign 0.00
R4133:Fancm UTSW 12 65120530 missense probably benign 0.44
R4308:Fancm UTSW 12 65126531 missense probably benign 0.14
R4588:Fancm UTSW 12 65118441 critical splice donor site probably null
R4602:Fancm UTSW 12 65124944 missense probably benign 0.12
R4653:Fancm UTSW 12 65083054 missense probably damaging 0.99
R4702:Fancm UTSW 12 65122052 missense possibly damaging 0.95
R4719:Fancm UTSW 12 65121706 missense possibly damaging 0.64
R4885:Fancm UTSW 12 65102643 nonsense probably null
R4896:Fancm UTSW 12 65075831 missense probably damaging 1.00
R4908:Fancm UTSW 12 65094871 missense probably benign 0.28
R4921:Fancm UTSW 12 65077141 missense probably benign 0.19
R4922:Fancm UTSW 12 65106892 critical splice donor site probably null
R4948:Fancm UTSW 12 65090974 missense probably damaging 1.00
R5103:Fancm UTSW 12 65105858 missense probably damaging 0.99
R5577:Fancm UTSW 12 65130411 utr 3 prime probably benign
R5631:Fancm UTSW 12 65113843 missense probably damaging 0.97
R5741:Fancm UTSW 12 65101615 missense probably benign 0.01
R6167:Fancm UTSW 12 65094895 missense probably benign 0.42
R6242:Fancm UTSW 12 65116442 missense probably benign 0.01
R6242:Fancm UTSW 12 65116449 missense probably benign 0.00
R6281:Fancm UTSW 12 65088270 missense probably damaging 1.00
R6325:Fancm UTSW 12 65125052 missense probably damaging 1.00
R6434:Fancm UTSW 12 65077168 missense probably damaging 1.00
R6493:Fancm UTSW 12 65097488 missense probably benign 0.04
R6542:Fancm UTSW 12 65097429 missense probably damaging 1.00
R6645:Fancm UTSW 12 65106100 missense probably damaging 0.99
R6878:Fancm UTSW 12 65116423 nonsense probably null
R7171:Fancm UTSW 12 65101620 missense probably damaging 0.99
R7172:Fancm UTSW 12 65106054 missense possibly damaging 0.95
R7498:Fancm UTSW 12 65099391 missense probably benign 0.01
R7585:Fancm UTSW 12 65106247 missense possibly damaging 0.62
R7610:Fancm UTSW 12 65105680 missense probably damaging 1.00
R7722:Fancm UTSW 12 65106461 missense probably damaging 1.00
R7740:Fancm UTSW 12 65126547 missense possibly damaging 0.90
R7867:Fancm UTSW 12 65116466 critical splice donor site probably null
R7867:Fancm UTSW 12 65118399 missense probably benign 0.12
R7882:Fancm UTSW 12 65126794 missense probably benign 0.12
R7928:Fancm UTSW 12 65106124 missense unknown
R8230:Fancm UTSW 12 65102650 missense probably benign 0.17
R8470:Fancm UTSW 12 65125157 missense probably damaging 1.00
R8553:Fancm UTSW 12 65126695 missense possibly damaging 0.62
R8695:Fancm UTSW 12 65125173 missense probably damaging 1.00
R8817:Fancm UTSW 12 65120557 missense probably damaging 1.00
Z1176:Fancm UTSW 12 65094926 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGCATCTCTATCATGAGCCAG -3'
(R):5'- AGTTTGTTTCACGGTCCAATC -3'

Sequencing Primer
(F):5'- GCTCCCCTGAAGAAATCT -3'
(R):5'- CACGGTCCAATCAAAATGATTATGG -3'
Posted On2017-10-10