Incidental Mutation 'R6137:Fer1l6'
ID488425
Institutional Source Beutler Lab
Gene Symbol Fer1l6
Ensembl Gene ENSMUSG00000037106
Gene Namefer-1-like 6 (C. elegans)
SynonymsEG631797
MMRRC Submission 044284-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R6137 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location58510048-58665092 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58559206 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 237 (S237P)
Ref Sequence ENSEMBL: ENSMUSP00000125718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161028]
Predicted Effect probably damaging
Transcript: ENSMUST00000161028
AA Change: S237P

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106
AA Change: S237P

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
C2 83 179 4.09e-12 SMART
FerI 165 235 2.06e-36 SMART
C2 243 354 5.19e-14 SMART
low complexity region 412 449 N/A INTRINSIC
FerB 714 787 2.53e-45 SMART
C2 829 936 8.84e-8 SMART
C2 1000 1099 3.05e0 SMART
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
C2 1361 1460 5.78e-12 SMART
low complexity region 1518 1529 N/A INTRINSIC
C2 1601 1731 1.01e-2 SMART
Pfam:Ferlin_C 1765 1857 2.3e-40 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A T 19: 8,740,784 D6V probably damaging Het
2310057M21Rik G T 7: 131,357,613 H165Q probably damaging Het
Akap13 T A 7: 75,677,416 F721Y probably damaging Het
Akap6 A T 12: 53,140,354 D1517V probably damaging Het
Amigo3 T A 9: 108,053,728 S117T probably damaging Het
Atf7ip2 T A 16: 10,201,411 N34K probably damaging Het
Cacnb1 A C 11: 98,005,782 V351G probably damaging Het
Casp9 T A 4: 141,805,349 probably null Het
Ccdc51 C T 9: 109,089,415 T24I probably benign Het
Cdh23 T A 10: 60,434,512 Y618F probably damaging Het
Chd1 T A 17: 15,758,688 W1271R probably damaging Het
Dars T C 1: 128,368,439 T386A probably benign Het
Dchs1 T A 7: 105,765,106 D834V probably damaging Het
Dgkd T A 1: 87,936,381 V933E possibly damaging Het
Dnah17 A G 11: 118,025,654 F4203S probably damaging Het
Fancm T C 12: 65,130,382 L2000P probably damaging Het
Fbxo11 A T 17: 88,008,669 H444Q probably benign Het
Fbxw14 T A 9: 109,276,222 T292S probably damaging Het
Frem3 T C 8: 80,615,047 I1323T probably benign Het
Grin2a A G 16: 9,653,449 F652L probably benign Het
Grin2b T A 6: 135,923,458 M142L possibly damaging Het
Helz A G 11: 107,619,060 Q503R possibly damaging Het
Ighv5-17 A G 12: 113,859,295 Y69H probably benign Het
Il17ra A G 6: 120,475,582 N242S probably benign Het
Immp1l G C 2: 105,964,208 G117A probably damaging Het
Itm2c T C 1: 85,894,692 V10A probably benign Het
Kif1b T C 4: 149,238,426 K679E possibly damaging Het
Kng1 T C 16: 23,074,645 V256A possibly damaging Het
Lamc2 T G 1: 153,166,153 R78S possibly damaging Het
Loxl4 A G 19: 42,598,793 F621S probably damaging Het
Lpl T A 8: 68,892,747 D134E probably damaging Het
Lypd3 T C 7: 24,640,494 Y329H probably benign Het
Mettl13 T C 1: 162,535,886 D225G probably benign Het
Myo7b A G 18: 31,999,974 F441L probably damaging Het
Nnt T A 13: 119,336,328 M699L possibly damaging Het
Nr1h3 A T 2: 91,191,851 M144K probably damaging Het
Olfr1040 A G 2: 86,145,969 V255A probably benign Het
Olfr1347 T C 7: 6,488,845 T3A probably benign Het
Olfr325 A T 11: 58,581,068 M75L probably benign Het
Pappa2 A T 1: 158,871,543 Y667N probably damaging Het
Prps1l3 A G 12: 57,238,888 I155V probably benign Het
Ptgs2 T A 1: 150,100,993 N24K probably benign Het
Ralgds A T 2: 28,547,588 M514L probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Sacm1l T A 9: 123,569,005 V254D probably damaging Het
Selenot A T 3: 58,585,284 Q64L probably damaging Het
Sgsm2 G A 11: 74,850,851 R1037W probably damaging Het
Slc22a12 A G 19: 6,542,724 V10A probably benign Het
Spem2 G T 11: 69,816,696 S481* probably null Het
Styk1 C T 6: 131,311,016 G128D probably damaging Het
Tmc6 A T 11: 117,776,328 L148Q probably damaging Het
Tmem138 A C 19: 10,574,835 probably null Het
Tnpo3 A G 6: 29,555,268 V772A probably benign Het
Topaz1 T C 9: 122,797,756 F1483S possibly damaging Het
Tuba4a C A 1: 75,216,055 C305F probably damaging Het
Ubap1 T G 4: 41,379,262 F159V possibly damaging Het
Vmn2r9 A G 5: 108,849,016 I129T probably benign Het
Wwc2 A T 8: 47,856,263 M828K unknown Het
Zfp236 A T 18: 82,671,794 S187T possibly damaging Het
Other mutations in Fer1l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0009:Fer1l6 UTSW 15 58662787 missense probably damaging 1.00
R0141:Fer1l6 UTSW 15 58558402 missense probably damaging 1.00
R0178:Fer1l6 UTSW 15 58637914 splice site probably null
R0304:Fer1l6 UTSW 15 58590562 missense probably benign 0.08
R0379:Fer1l6 UTSW 15 58548338 missense probably benign 0.05
R0457:Fer1l6 UTSW 15 58638094 critical splice donor site probably null
R0546:Fer1l6 UTSW 15 58558408 splice site probably null
R0602:Fer1l6 UTSW 15 58577945 missense probably damaging 0.98
R0619:Fer1l6 UTSW 15 58662935 splice site probably null
R0669:Fer1l6 UTSW 15 58553724 splice site probably null
R0854:Fer1l6 UTSW 15 58559188 missense probably benign 0.00
R0948:Fer1l6 UTSW 15 58564075 missense probably benign 0.00
R1180:Fer1l6 UTSW 15 58602311 splice site probably benign
R1483:Fer1l6 UTSW 15 58637970 missense possibly damaging 0.84
R1627:Fer1l6 UTSW 15 58641879 missense probably benign 0.41
R1635:Fer1l6 UTSW 15 58647081 missense probably damaging 1.00
R1834:Fer1l6 UTSW 15 58557869 missense possibly damaging 0.58
R1921:Fer1l6 UTSW 15 58625231 missense probably damaging 1.00
R2000:Fer1l6 UTSW 15 58602311 splice site probably benign
R2041:Fer1l6 UTSW 15 58558306 missense probably damaging 1.00
R2144:Fer1l6 UTSW 15 58627534 missense probably benign
R2145:Fer1l6 UTSW 15 58627534 missense probably benign
R2981:Fer1l6 UTSW 15 58564077 missense probably damaging 0.99
R4164:Fer1l6 UTSW 15 58559238 missense possibly damaging 0.83
R4192:Fer1l6 UTSW 15 58647149 missense probably damaging 1.00
R4273:Fer1l6 UTSW 15 58627522 missense probably benign 0.41
R4573:Fer1l6 UTSW 15 58626280 critical splice donor site probably null
R4581:Fer1l6 UTSW 15 58640226 missense probably damaging 1.00
R4624:Fer1l6 UTSW 15 58553705 missense probably damaging 1.00
R4755:Fer1l6 UTSW 15 58640211 missense probably benign 0.09
R4774:Fer1l6 UTSW 15 58577949 missense probably damaging 0.99
R4894:Fer1l6 UTSW 15 58618902 missense probably damaging 1.00
R4896:Fer1l6 UTSW 15 58638020 missense probably damaging 1.00
R4921:Fer1l6 UTSW 15 58600311 critical splice acceptor site probably null
R4962:Fer1l6 UTSW 15 58571401 missense probably benign 0.03
R5029:Fer1l6 UTSW 15 58643920 missense probably benign 0.00
R5134:Fer1l6 UTSW 15 58640154 missense probably damaging 1.00
R5175:Fer1l6 UTSW 15 58550277 missense probably damaging 1.00
R5227:Fer1l6 UTSW 15 58581903 nonsense probably null
R5561:Fer1l6 UTSW 15 58660825 missense probably damaging 0.97
R5621:Fer1l6 UTSW 15 58558326 missense probably damaging 1.00
R5670:Fer1l6 UTSW 15 58622482 missense probably benign 0.00
R5745:Fer1l6 UTSW 15 58571389 missense probably benign 0.01
R5807:Fer1l6 UTSW 15 58590550 nonsense probably null
R5823:Fer1l6 UTSW 15 58590503 nonsense probably null
R5892:Fer1l6 UTSW 15 58564068 missense probably benign
R6006:Fer1l6 UTSW 15 58647044 missense probably damaging 1.00
R6195:Fer1l6 UTSW 15 58637957 missense probably damaging 1.00
R6234:Fer1l6 UTSW 15 58560639 missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58625177 nonsense probably null
R6237:Fer1l6 UTSW 15 58638006 missense probably damaging 1.00
R6271:Fer1l6 UTSW 15 58641918 missense probably benign 0.01
R6336:Fer1l6 UTSW 15 58559232 nonsense probably null
R6784:Fer1l6 UTSW 15 58571426 missense possibly damaging 0.63
R6852:Fer1l6 UTSW 15 58594878 missense probably damaging 1.00
R7030:Fer1l6 UTSW 15 58629378 missense probably damaging 1.00
R7088:Fer1l6 UTSW 15 58564050 missense possibly damaging 0.69
R7181:Fer1l6 UTSW 15 58575297 missense probably benign 0.00
R7226:Fer1l6 UTSW 15 58590535 missense probably benign 0.00
R7266:Fer1l6 UTSW 15 58627597 missense probably benign
R7463:Fer1l6 UTSW 15 58573601 nonsense probably null
R7464:Fer1l6 UTSW 15 58573247 splice site probably null
R7469:Fer1l6 UTSW 15 58590570 splice site probably null
R7483:Fer1l6 UTSW 15 58641945 missense possibly damaging 0.83
R7491:Fer1l6 UTSW 15 58600432 missense probably damaging 1.00
R7534:Fer1l6 UTSW 15 58638026 missense probably damaging 1.00
R7562:Fer1l6 UTSW 15 58560482 missense probably benign 0.00
R7580:Fer1l6 UTSW 15 58558396 missense probably benign 0.41
R7599:Fer1l6 UTSW 15 58627589 missense probably benign
R7607:Fer1l6 UTSW 15 58662732 nonsense probably null
R7677:Fer1l6 UTSW 15 58602290 missense probably benign 0.00
R8202:Fer1l6 UTSW 15 58630637 missense probably damaging 1.00
R8261:Fer1l6 UTSW 15 58560496 missense possibly damaging 0.84
X0021:Fer1l6 UTSW 15 58569202 nonsense probably null
X0027:Fer1l6 UTSW 15 58629340 missense probably damaging 1.00
X0063:Fer1l6 UTSW 15 58618574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACCACTGGTTTATGACACAC -3'
(R):5'- TGACAAAGTTTCCTCACCGTC -3'

Sequencing Primer
(F):5'- TTAGTGATGGACCCCAGT -3'
(R):5'- GTCTGCCCAGCAAAGGAC -3'
Posted On2017-10-10