Incidental Mutation 'R6137:Atf7ip2'
ID488427
Institutional Source Beutler Lab
Gene Symbol Atf7ip2
Ensembl Gene ENSMUSG00000039200
Gene Nameactivating transcription factor 7 interacting protein 2
Synonyms4930558K11Rik, PSM2, Get-1
MMRRC Submission 044284-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R6137 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location10192712-10251478 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10201411 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 34 (N34K)
Ref Sequence ENSEMBL: ENSMUSP00000113480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044005] [ENSMUST00000100191] [ENSMUST00000117220] [ENSMUST00000119023]
Predicted Effect probably damaging
Transcript: ENSMUST00000044005
AA Change: N34K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036731
Gene: ENSMUSG00000039200
AA Change: N34K

DomainStartEndE-ValueType
Pfam:ATF7IP_BD 59 270 4.7e-75 PFAM
low complexity region 322 336 N/A INTRINSIC
FN3 346 435 7.55e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100191
AA Change: N34K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097766
Gene: ENSMUSG00000039200
AA Change: N34K

DomainStartEndE-ValueType
low complexity region 180 192 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117220
AA Change: N34K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113573
Gene: ENSMUSG00000039200
AA Change: N34K

DomainStartEndE-ValueType
low complexity region 180 192 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119023
AA Change: N34K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113480
Gene: ENSMUSG00000039200
AA Change: N34K

DomainStartEndE-ValueType
low complexity region 180 192 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230210
Meta Mutation Damage Score 0.1576 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A T 19: 8,740,784 D6V probably damaging Het
2310057M21Rik G T 7: 131,357,613 H165Q probably damaging Het
Akap13 T A 7: 75,677,416 F721Y probably damaging Het
Akap6 A T 12: 53,140,354 D1517V probably damaging Het
Amigo3 T A 9: 108,053,728 S117T probably damaging Het
Cacnb1 A C 11: 98,005,782 V351G probably damaging Het
Casp9 T A 4: 141,805,349 probably null Het
Ccdc51 C T 9: 109,089,415 T24I probably benign Het
Cdh23 T A 10: 60,434,512 Y618F probably damaging Het
Chd1 T A 17: 15,758,688 W1271R probably damaging Het
Dars T C 1: 128,368,439 T386A probably benign Het
Dchs1 T A 7: 105,765,106 D834V probably damaging Het
Dgkd T A 1: 87,936,381 V933E possibly damaging Het
Dnah17 A G 11: 118,025,654 F4203S probably damaging Het
Fancm T C 12: 65,130,382 L2000P probably damaging Het
Fbxo11 A T 17: 88,008,669 H444Q probably benign Het
Fbxw14 T A 9: 109,276,222 T292S probably damaging Het
Fer1l6 T C 15: 58,559,206 S237P probably damaging Het
Frem3 T C 8: 80,615,047 I1323T probably benign Het
Grin2a A G 16: 9,653,449 F652L probably benign Het
Grin2b T A 6: 135,923,458 M142L possibly damaging Het
Helz A G 11: 107,619,060 Q503R possibly damaging Het
Ighv5-17 A G 12: 113,859,295 Y69H probably benign Het
Il17ra A G 6: 120,475,582 N242S probably benign Het
Immp1l G C 2: 105,964,208 G117A probably damaging Het
Itm2c T C 1: 85,894,692 V10A probably benign Het
Kif1b T C 4: 149,238,426 K679E possibly damaging Het
Kng1 T C 16: 23,074,645 V256A possibly damaging Het
Lamc2 T G 1: 153,166,153 R78S possibly damaging Het
Loxl4 A G 19: 42,598,793 F621S probably damaging Het
Lpl T A 8: 68,892,747 D134E probably damaging Het
Lypd3 T C 7: 24,640,494 Y329H probably benign Het
Mettl13 T C 1: 162,535,886 D225G probably benign Het
Myo7b A G 18: 31,999,974 F441L probably damaging Het
Nnt T A 13: 119,336,328 M699L possibly damaging Het
Nr1h3 A T 2: 91,191,851 M144K probably damaging Het
Olfr1040 A G 2: 86,145,969 V255A probably benign Het
Olfr1347 T C 7: 6,488,845 T3A probably benign Het
Olfr325 A T 11: 58,581,068 M75L probably benign Het
Pappa2 A T 1: 158,871,543 Y667N probably damaging Het
Prps1l3 A G 12: 57,238,888 I155V probably benign Het
Ptgs2 T A 1: 150,100,993 N24K probably benign Het
Ralgds A T 2: 28,547,588 M514L probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Sacm1l T A 9: 123,569,005 V254D probably damaging Het
Selenot A T 3: 58,585,284 Q64L probably damaging Het
Sgsm2 G A 11: 74,850,851 R1037W probably damaging Het
Slc22a12 A G 19: 6,542,724 V10A probably benign Het
Spem2 G T 11: 69,816,696 S481* probably null Het
Styk1 C T 6: 131,311,016 G128D probably damaging Het
Tmc6 A T 11: 117,776,328 L148Q probably damaging Het
Tmem138 A C 19: 10,574,835 probably null Het
Tnpo3 A G 6: 29,555,268 V772A probably benign Het
Topaz1 T C 9: 122,797,756 F1483S possibly damaging Het
Tuba4a C A 1: 75,216,055 C305F probably damaging Het
Ubap1 T G 4: 41,379,262 F159V possibly damaging Het
Vmn2r9 A G 5: 108,849,016 I129T probably benign Het
Wwc2 A T 8: 47,856,263 M828K unknown Het
Zfp236 A T 18: 82,671,794 S187T possibly damaging Het
Other mutations in Atf7ip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01926:Atf7ip2 APN 16 10241885 missense probably damaging 0.99
IGL01937:Atf7ip2 APN 16 10241537 splice site probably null
IGL02301:Atf7ip2 APN 16 10211047 missense probably benign 0.32
R0575:Atf7ip2 UTSW 16 10237211 missense probably damaging 1.00
R0671:Atf7ip2 UTSW 16 10241879 missense possibly damaging 0.86
R1119:Atf7ip2 UTSW 16 10240612 missense possibly damaging 0.83
R1182:Atf7ip2 UTSW 16 10241835 missense possibly damaging 0.93
R1302:Atf7ip2 UTSW 16 10240608 missense possibly damaging 0.84
R1346:Atf7ip2 UTSW 16 10234331 missense probably damaging 1.00
R1349:Atf7ip2 UTSW 16 10234331 missense probably damaging 1.00
R1372:Atf7ip2 UTSW 16 10234331 missense probably damaging 1.00
R1672:Atf7ip2 UTSW 16 10209141 missense probably damaging 1.00
R1696:Atf7ip2 UTSW 16 10234331 missense probably damaging 1.00
R1897:Atf7ip2 UTSW 16 10211084 missense probably damaging 0.97
R1932:Atf7ip2 UTSW 16 10241703 missense possibly damaging 0.86
R2143:Atf7ip2 UTSW 16 10240645 missense probably null 0.68
R4612:Atf7ip2 UTSW 16 10241563 missense probably benign 0.33
R4732:Atf7ip2 UTSW 16 10241886 missense possibly damaging 0.92
R4733:Atf7ip2 UTSW 16 10241886 missense possibly damaging 0.92
R4934:Atf7ip2 UTSW 16 10241583 missense possibly damaging 0.72
R6432:Atf7ip2 UTSW 16 10204670 missense probably damaging 1.00
R7298:Atf7ip2 UTSW 16 10209168 missense possibly damaging 0.82
R7517:Atf7ip2 UTSW 16 10241535 splice site probably null
R7744:Atf7ip2 UTSW 16 10241658 missense possibly damaging 0.93
R8124:Atf7ip2 UTSW 16 10209135 missense possibly damaging 0.67
R8245:Atf7ip2 UTSW 16 10201398 missense possibly damaging 0.93
R8527:Atf7ip2 UTSW 16 10237265 intron probably benign
U24488:Atf7ip2 UTSW 16 10204673 missense probably damaging 0.96
X0062:Atf7ip2 UTSW 16 10209274 splice site probably null
Z1177:Atf7ip2 UTSW 16 10241640 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GATCCTCCTATTGGTACCACTG -3'
(R):5'- GGAGTCAATAGCTGTCCTTGGC -3'

Sequencing Primer
(F):5'- ACCACTGTCTTCATTATAGTATGACC -3'
(R):5'- CAATAGCTGTCCTTGGCTTTGTG -3'
Posted On2017-10-10