Incidental Mutation 'R6137:Kng1'
ID488428
Institutional Source Beutler Lab
Gene Symbol Kng1
Ensembl Gene ENSMUSG00000022875
Gene Namekininogen 1
SynonymsH-kininigen, L-kininogen
MMRRC Submission 044284-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6137 (G1)
Quality Score147.008
Status Not validated
Chromosome16
Chromosomal Location23057865-23082078 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23074645 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 256 (V256A)
Ref Sequence ENSEMBL: ENSMUSP00000040485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023589] [ENSMUST00000039492] [ENSMUST00000089902]
Predicted Effect probably benign
Transcript: ENSMUST00000023589
AA Change: V256A

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023589
Gene: ENSMUSG00000022875
AA Change: V256A

DomainStartEndE-ValueType
CY 18 126 3.61e-17 SMART
CY 140 248 6.46e-28 SMART
CY 262 370 2.96e-36 SMART
low complexity region 439 450 N/A INTRINSIC
low complexity region 494 524 N/A INTRINSIC
low complexity region 541 555 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000039492
AA Change: V256A

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000040485
Gene: ENSMUSG00000022875
AA Change: V256A

DomainStartEndE-ValueType
CY 18 126 3.61e-17 SMART
CY 140 248 6.46e-28 SMART
CY 262 370 2.96e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089902
AA Change: V256A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000087346
Gene: ENSMUSG00000022875
AA Change: V256A

DomainStartEndE-ValueType
CY 18 126 3.61e-17 SMART
CY 140 248 6.46e-28 SMART
CY 262 370 2.96e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136778
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (58/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation are viable and grossly unaffected with normal tail vein bleeding times, despite loss of detectable plasma kininogen. However, homozygotes show a significantly longer time to carotid artery occlusion after RoseBengal and laser-induced arterial injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A T 19: 8,740,784 D6V probably damaging Het
2310057M21Rik G T 7: 131,357,613 H165Q probably damaging Het
Akap13 T A 7: 75,677,416 F721Y probably damaging Het
Akap6 A T 12: 53,140,354 D1517V probably damaging Het
Amigo3 T A 9: 108,053,728 S117T probably damaging Het
Atf7ip2 T A 16: 10,201,411 N34K probably damaging Het
Cacnb1 A C 11: 98,005,782 V351G probably damaging Het
Casp9 T A 4: 141,805,349 probably null Het
Ccdc51 C T 9: 109,089,415 T24I probably benign Het
Cdh23 T A 10: 60,434,512 Y618F probably damaging Het
Chd1 T A 17: 15,758,688 W1271R probably damaging Het
Dars T C 1: 128,368,439 T386A probably benign Het
Dchs1 T A 7: 105,765,106 D834V probably damaging Het
Dgkd T A 1: 87,936,381 V933E possibly damaging Het
Dnah17 A G 11: 118,025,654 F4203S probably damaging Het
Fancm T C 12: 65,130,382 L2000P probably damaging Het
Fbxo11 A T 17: 88,008,669 H444Q probably benign Het
Fbxw14 T A 9: 109,276,222 T292S probably damaging Het
Fer1l6 T C 15: 58,559,206 S237P probably damaging Het
Frem3 T C 8: 80,615,047 I1323T probably benign Het
Grin2a A G 16: 9,653,449 F652L probably benign Het
Grin2b T A 6: 135,923,458 M142L possibly damaging Het
Helz A G 11: 107,619,060 Q503R possibly damaging Het
Ighv5-17 A G 12: 113,859,295 Y69H probably benign Het
Il17ra A G 6: 120,475,582 N242S probably benign Het
Immp1l G C 2: 105,964,208 G117A probably damaging Het
Itm2c T C 1: 85,894,692 V10A probably benign Het
Kif1b T C 4: 149,238,426 K679E possibly damaging Het
Lamc2 T G 1: 153,166,153 R78S possibly damaging Het
Loxl4 A G 19: 42,598,793 F621S probably damaging Het
Lpl T A 8: 68,892,747 D134E probably damaging Het
Lypd3 T C 7: 24,640,494 Y329H probably benign Het
Mettl13 T C 1: 162,535,886 D225G probably benign Het
Myo7b A G 18: 31,999,974 F441L probably damaging Het
Nnt T A 13: 119,336,328 M699L possibly damaging Het
Nr1h3 A T 2: 91,191,851 M144K probably damaging Het
Olfr1040 A G 2: 86,145,969 V255A probably benign Het
Olfr1347 T C 7: 6,488,845 T3A probably benign Het
Olfr325 A T 11: 58,581,068 M75L probably benign Het
Pappa2 A T 1: 158,871,543 Y667N probably damaging Het
Prps1l3 A G 12: 57,238,888 I155V probably benign Het
Ptgs2 T A 1: 150,100,993 N24K probably benign Het
Ralgds A T 2: 28,547,588 M514L probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Sacm1l T A 9: 123,569,005 V254D probably damaging Het
Selenot A T 3: 58,585,284 Q64L probably damaging Het
Sgsm2 G A 11: 74,850,851 R1037W probably damaging Het
Slc22a12 A G 19: 6,542,724 V10A probably benign Het
Spem2 G T 11: 69,816,696 S481* probably null Het
Styk1 C T 6: 131,311,016 G128D probably damaging Het
Tmc6 A T 11: 117,776,328 L148Q probably damaging Het
Tmem138 A C 19: 10,574,835 probably null Het
Tnpo3 A G 6: 29,555,268 V772A probably benign Het
Topaz1 T C 9: 122,797,756 F1483S possibly damaging Het
Tuba4a C A 1: 75,216,055 C305F probably damaging Het
Ubap1 T G 4: 41,379,262 F159V possibly damaging Het
Vmn2r9 A G 5: 108,849,016 I129T probably benign Het
Wwc2 A T 8: 47,856,263 M828K unknown Het
Zfp236 A T 18: 82,671,794 S187T possibly damaging Het
Other mutations in Kng1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01460:Kng1 APN 16 23079194 missense probably benign 0.26
IGL01754:Kng1 APN 16 23079614 missense probably benign 0.10
IGL02049:Kng1 APN 16 23073437 missense probably damaging 0.99
IGL02138:Kng1 APN 16 23067808 missense probably damaging 0.99
IGL02216:Kng1 APN 16 23058533 missense probably damaging 0.98
IGL02230:Kng1 APN 16 23060494 critical splice donor site probably null
IGL02630:Kng1 APN 16 23079845 utr 3 prime probably benign
IGL03024:Kng1 APN 16 23074692 missense possibly damaging 0.92
R0518:Kng1 UTSW 16 23060482 missense possibly damaging 0.70
R0521:Kng1 UTSW 16 23060482 missense possibly damaging 0.70
R1352:Kng1 UTSW 16 23067694 critical splice acceptor site probably null
R1396:Kng1 UTSW 16 23078980 missense probably benign 0.00
R1514:Kng1 UTSW 16 23079760 missense probably damaging 0.97
R1753:Kng1 UTSW 16 23079119 missense possibly damaging 0.68
R2048:Kng1 UTSW 16 23058604 missense probably damaging 0.98
R2290:Kng1 UTSW 16 23079125 missense possibly damaging 0.79
R2357:Kng1 UTSW 16 23079065 missense possibly damaging 0.88
R3014:Kng1 UTSW 16 23079370 missense possibly damaging 0.72
R3607:Kng1 UTSW 16 23067802 missense probably damaging 1.00
R4322:Kng1 UTSW 16 23079520 missense probably benign
R4334:Kng1 UTSW 16 23079620 missense possibly damaging 0.88
R4388:Kng1 UTSW 16 23079318 missense possibly damaging 0.63
R4558:Kng1 UTSW 16 23077418 splice site probably null
R4887:Kng1 UTSW 16 23067698 missense possibly damaging 0.71
R5115:Kng1 UTSW 16 23069282 missense possibly damaging 0.87
R5288:Kng1 UTSW 16 23079092 missense probably damaging 0.96
R5461:Kng1 UTSW 16 23079137 missense probably benign 0.19
R5894:Kng1 UTSW 16 23073363 missense probably benign 0.08
R6260:Kng1 UTSW 16 23058621 missense possibly damaging 0.66
R6291:Kng1 UTSW 16 23079725 missense probably damaging 1.00
R6620:Kng1 UTSW 16 23081482 missense possibly damaging 0.74
R6947:Kng1 UTSW 16 23077374 missense probably benign 0.21
R7142:Kng1 UTSW 16 23079420 missense probably benign 0.25
R7166:Kng1 UTSW 16 23079678 missense probably benign 0.00
R7168:Kng1 UTSW 16 23079641 missense probably benign 0.26
R7347:Kng1 UTSW 16 23067787 missense possibly damaging 0.46
Z1176:Kng1 UTSW 16 23079616 missense probably benign 0.00
Z1177:Kng1 UTSW 16 23073389 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TAGCATATGGGTGAACATGGGC -3'
(R):5'- ATGTACAGACCTGTGATGTTGC -3'

Sequencing Primer
(F):5'- TGGGCAAACACGCTTCC -3'
(R):5'- ATGACCAAGCACCTCCTT -3'
Posted On2017-10-10