Incidental Mutation 'R6137:Myo7b'
ID488431
Institutional Source Beutler Lab
Gene Symbol Myo7b
Ensembl Gene ENSMUSG00000024388
Gene Namemyosin VIIB
Synonyms
MMRRC Submission 044284-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6137 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location31959234-32036961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31999974 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 441 (F441L)
Ref Sequence ENSEMBL: ENSMUSP00000118046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134663]
Predicted Effect probably damaging
Transcript: ENSMUST00000134663
AA Change: F441L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118046
Gene: ENSMUSG00000024388
AA Change: F441L

DomainStartEndE-ValueType
MYSc 59 761 N/A SMART
IQ 762 784 1.07e-1 SMART
IQ 785 807 7.01e-6 SMART
IQ 831 853 4.93e-1 SMART
IQ 854 876 1.63e-1 SMART
MyTH4 989 1189 1.14e-71 SMART
B41 1190 1409 3.66e-16 SMART
SH3 1501 1563 3.25e-7 SMART
MyTH4 1641 1790 7.66e-55 SMART
B41 1792 2009 8.19e-28 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in brush border microvilli of epithelial cells in the intestines and kidneys. The encoded protein is involved in linking protocadherins to the actin cytoskeleton and is essential for proper microvilli function. This protein aids in the accumulation of intermicrovillar adhesion components such as harmonin and ANKS4B, and this accumulation is necessary for normal brush border action. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A T 19: 8,740,784 D6V probably damaging Het
2310057M21Rik G T 7: 131,357,613 H165Q probably damaging Het
Akap13 T A 7: 75,677,416 F721Y probably damaging Het
Akap6 A T 12: 53,140,354 D1517V probably damaging Het
Amigo3 T A 9: 108,053,728 S117T probably damaging Het
Atf7ip2 T A 16: 10,201,411 N34K probably damaging Het
Cacnb1 A C 11: 98,005,782 V351G probably damaging Het
Casp9 T A 4: 141,805,349 probably null Het
Ccdc51 C T 9: 109,089,415 T24I probably benign Het
Cdh23 T A 10: 60,434,512 Y618F probably damaging Het
Chd1 T A 17: 15,758,688 W1271R probably damaging Het
Dars T C 1: 128,368,439 T386A probably benign Het
Dchs1 T A 7: 105,765,106 D834V probably damaging Het
Dgkd T A 1: 87,936,381 V933E possibly damaging Het
Dnah17 A G 11: 118,025,654 F4203S probably damaging Het
Fancm T C 12: 65,130,382 L2000P probably damaging Het
Fbxo11 A T 17: 88,008,669 H444Q probably benign Het
Fbxw14 T A 9: 109,276,222 T292S probably damaging Het
Fer1l6 T C 15: 58,559,206 S237P probably damaging Het
Frem3 T C 8: 80,615,047 I1323T probably benign Het
Grin2a A G 16: 9,653,449 F652L probably benign Het
Grin2b T A 6: 135,923,458 M142L possibly damaging Het
Helz A G 11: 107,619,060 Q503R possibly damaging Het
Ighv5-17 A G 12: 113,859,295 Y69H probably benign Het
Il17ra A G 6: 120,475,582 N242S probably benign Het
Immp1l G C 2: 105,964,208 G117A probably damaging Het
Itm2c T C 1: 85,894,692 V10A probably benign Het
Kif1b T C 4: 149,238,426 K679E possibly damaging Het
Kng1 T C 16: 23,074,645 V256A possibly damaging Het
Lamc2 T G 1: 153,166,153 R78S possibly damaging Het
Loxl4 A G 19: 42,598,793 F621S probably damaging Het
Lpl T A 8: 68,892,747 D134E probably damaging Het
Lypd3 T C 7: 24,640,494 Y329H probably benign Het
Mettl13 T C 1: 162,535,886 D225G probably benign Het
Nnt T A 13: 119,336,328 M699L possibly damaging Het
Nr1h3 A T 2: 91,191,851 M144K probably damaging Het
Olfr1040 A G 2: 86,145,969 V255A probably benign Het
Olfr1347 T C 7: 6,488,845 T3A probably benign Het
Olfr325 A T 11: 58,581,068 M75L probably benign Het
Pappa2 A T 1: 158,871,543 Y667N probably damaging Het
Prps1l3 A G 12: 57,238,888 I155V probably benign Het
Ptgs2 T A 1: 150,100,993 N24K probably benign Het
Ralgds A T 2: 28,547,588 M514L probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Sacm1l T A 9: 123,569,005 V254D probably damaging Het
Selenot A T 3: 58,585,284 Q64L probably damaging Het
Sgsm2 G A 11: 74,850,851 R1037W probably damaging Het
Slc22a12 A G 19: 6,542,724 V10A probably benign Het
Spem2 G T 11: 69,816,696 S481* probably null Het
Styk1 C T 6: 131,311,016 G128D probably damaging Het
Tmc6 A T 11: 117,776,328 L148Q probably damaging Het
Tmem138 A C 19: 10,574,835 probably null Het
Tnpo3 A G 6: 29,555,268 V772A probably benign Het
Topaz1 T C 9: 122,797,756 F1483S possibly damaging Het
Tuba4a C A 1: 75,216,055 C305F probably damaging Het
Ubap1 T G 4: 41,379,262 F159V possibly damaging Het
Vmn2r9 A G 5: 108,849,016 I129T probably benign Het
Wwc2 A T 8: 47,856,263 M828K unknown Het
Zfp236 A T 18: 82,671,794 S187T possibly damaging Het
Other mutations in Myo7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Myo7b APN 18 32021556 utr 5 prime probably benign
IGL01799:Myo7b APN 18 31962770 missense probably damaging 1.00
IGL01881:Myo7b APN 18 32000267 splice site probably benign
IGL01883:Myo7b APN 18 31998151 missense probably damaging 1.00
IGL01934:Myo7b APN 18 32001341 critical splice donor site probably null
IGL01980:Myo7b APN 18 31961900 missense possibly damaging 0.86
IGL02506:Myo7b APN 18 31967154 missense probably damaging 1.00
IGL02704:Myo7b APN 18 31966961 missense probably benign 0.13
IGL02929:Myo7b APN 18 31994925 missense probably benign 0.19
IGL03149:Myo7b APN 18 32014302 missense probably damaging 1.00
IGL03335:Myo7b APN 18 31985020 missense possibly damaging 0.81
IGL03372:Myo7b APN 18 31998601 missense probably damaging 1.00
IGL03385:Myo7b APN 18 31989577 missense probably benign 0.00
PIT4131001:Myo7b UTSW 18 31961206 missense probably benign 0.17
PIT4445001:Myo7b UTSW 18 31959466 missense possibly damaging 0.80
PIT4445001:Myo7b UTSW 18 31962352 missense probably damaging 0.96
R0034:Myo7b UTSW 18 31960860 missense probably damaging 1.00
R0138:Myo7b UTSW 18 32010151 missense probably damaging 1.00
R0149:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0226:Myo7b UTSW 18 31972896 missense probably benign 0.00
R0312:Myo7b UTSW 18 32014337 missense possibly damaging 0.68
R0361:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0506:Myo7b UTSW 18 31964386 critical splice donor site probably null
R0524:Myo7b UTSW 18 32013424 missense possibly damaging 0.91
R0645:Myo7b UTSW 18 31994909 missense probably benign 0.10
R0724:Myo7b UTSW 18 32005549 splice site probably benign
R0731:Myo7b UTSW 18 31961825 splice site probably null
R0762:Myo7b UTSW 18 31983944 missense probably benign 0.01
R0843:Myo7b UTSW 18 31974084 missense possibly damaging 0.83
R0894:Myo7b UTSW 18 32000070 missense probably damaging 1.00
R0966:Myo7b UTSW 18 31998763 missense probably damaging 1.00
R1205:Myo7b UTSW 18 31994342 missense probably damaging 1.00
R1387:Myo7b UTSW 18 31983752 splice site probably benign
R1523:Myo7b UTSW 18 31966876 missense probably damaging 1.00
R1544:Myo7b UTSW 18 31994909 missense probably benign 0.10
R1623:Myo7b UTSW 18 32000051 missense probably damaging 1.00
R1780:Myo7b UTSW 18 31961185 missense probably damaging 1.00
R1785:Myo7b UTSW 18 31994897 missense probably benign
R1786:Myo7b UTSW 18 31994897 missense probably benign
R1796:Myo7b UTSW 18 31986675 missense possibly damaging 0.93
R1907:Myo7b UTSW 18 31976999 missense possibly damaging 0.89
R2027:Myo7b UTSW 18 31984960 missense probably benign
R2102:Myo7b UTSW 18 31999978 missense probably damaging 1.00
R2174:Myo7b UTSW 18 31983557 missense probably damaging 1.00
R2272:Myo7b UTSW 18 31977043 missense probably benign 0.41
R2323:Myo7b UTSW 18 31971345 missense probably damaging 1.00
R2365:Myo7b UTSW 18 32014331 missense probably damaging 0.98
R3078:Myo7b UTSW 18 31967184 missense probably benign 0.04
R3522:Myo7b UTSW 18 32010079 missense probably damaging 1.00
R3788:Myo7b UTSW 18 31974112 missense possibly damaging 0.95
R3880:Myo7b UTSW 18 31969514 missense probably damaging 0.96
R4334:Myo7b UTSW 18 31976987 missense probably damaging 1.00
R4343:Myo7b UTSW 18 31983627 missense probably damaging 1.00
R4497:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4498:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4551:Myo7b UTSW 18 31985108 missense probably benign 0.01
R4593:Myo7b UTSW 18 32013375 missense possibly damaging 0.77
R4616:Myo7b UTSW 18 32003487 splice site probably null
R4646:Myo7b UTSW 18 31994369 missense probably benign 0.25
R4648:Myo7b UTSW 18 31967125 splice site probably null
R4737:Myo7b UTSW 18 31998602 missense probably damaging 1.00
R4765:Myo7b UTSW 18 31961900 missense probably benign 0.00
R4790:Myo7b UTSW 18 32000105 splice site probably null
R4909:Myo7b UTSW 18 31964436 missense probably benign 0.01
R5027:Myo7b UTSW 18 31975212 missense probably benign 0.22
R5034:Myo7b UTSW 18 31971387 missense probably damaging 1.00
R5112:Myo7b UTSW 18 31983587 missense probably damaging 1.00
R5266:Myo7b UTSW 18 31998734 missense probably damaging 1.00
R5267:Myo7b UTSW 18 31998734 missense probably damaging 1.00
R5348:Myo7b UTSW 18 31983919 missense probably damaging 0.96
R5457:Myo7b UTSW 18 31971450 splice site probably null
R5540:Myo7b UTSW 18 32007090 missense probably damaging 1.00
R5628:Myo7b UTSW 18 31974187 missense probably benign
R5815:Myo7b UTSW 18 31966288 missense probably damaging 1.00
R6062:Myo7b UTSW 18 31967990 missense possibly damaging 0.94
R6158:Myo7b UTSW 18 31988549 missense probably benign 0.00
R6218:Myo7b UTSW 18 31959454 missense probably benign 0.10
R6256:Myo7b UTSW 18 31983695 missense probably damaging 1.00
R6257:Myo7b UTSW 18 32013415 missense probably damaging 1.00
R6265:Myo7b UTSW 18 31998150 missense probably damaging 1.00
R6302:Myo7b UTSW 18 31994386 missense probably damaging 0.98
R6438:Myo7b UTSW 18 31966329 missense probably damaging 1.00
R6654:Myo7b UTSW 18 31990269 missense possibly damaging 0.46
R7030:Myo7b UTSW 18 31971573 missense probably damaging 1.00
R7090:Myo7b UTSW 18 31998712 missense probably damaging 1.00
R7210:Myo7b UTSW 18 32007102 missense probably damaging 1.00
R7218:Myo7b UTSW 18 31981001 missense probably benign 0.05
R7378:Myo7b UTSW 18 31966239 missense probably damaging 1.00
R7458:Myo7b UTSW 18 31988551 missense possibly damaging 0.89
R7517:Myo7b UTSW 18 32013267 missense probably damaging 0.99
R7559:Myo7b UTSW 18 31983360 missense probably benign 0.01
R7667:Myo7b UTSW 18 31961905 missense probably benign
R7737:Myo7b UTSW 18 32014204 nonsense probably null
R7942:Myo7b UTSW 18 32013369 missense probably damaging 0.98
R8030:Myo7b UTSW 18 31998082 missense probably damaging 0.96
R8114:Myo7b UTSW 18 31965624 missense probably damaging 1.00
R8338:Myo7b UTSW 18 31971355 missense probably damaging 0.96
R8341:Myo7b UTSW 18 31983926 missense probably benign 0.39
R8406:Myo7b UTSW 18 31959813 missense probably damaging 1.00
R8464:Myo7b UTSW 18 31962704 missense probably benign 0.00
R8517:Myo7b UTSW 18 31967191 missense possibly damaging 0.87
R8537:Myo7b UTSW 18 31977089 missense probably benign 0.08
R8546:Myo7b UTSW 18 31990148 missense probably benign 0.19
R8721:Myo7b UTSW 18 32007011 missense probably damaging 1.00
R8770:Myo7b UTSW 18 31981071 missense probably benign 0.03
X0027:Myo7b UTSW 18 31965636 missense probably damaging 1.00
Z1176:Myo7b UTSW 18 31980998 missense possibly damaging 0.82
Z1177:Myo7b UTSW 18 31985056 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGTGTGTACAGAGGTAAACTTAC -3'
(R):5'- GAGTCAGTGTTGCCAGTCTG -3'

Sequencing Primer
(F):5'- AGACTGAGTCTCTTCACCAATTCAG -3'
(R):5'- TTCCTGGGTGAACCTCAAGAG -3'
Posted On2017-10-10