Incidental Mutation 'R6137:Tmem138'
ID488435
Institutional Source Beutler Lab
Gene Symbol Tmem138
Ensembl Gene ENSMUSG00000024666
Gene Nametransmembrane protein 138
Synonyms1700113I01Rik, 2900055D14Rik
MMRRC Submission 044284-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6137 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location10570478-10577362 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 10574835 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025568] [ENSMUST00000168445]
Predicted Effect probably null
Transcript: ENSMUST00000025568
SMART Domains Protein: ENSMUSP00000025568
Gene: ENSMUSG00000024666

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:TMEM138 38 156 4.7e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168445
SMART Domains Protein: ENSMUSP00000130680
Gene: ENSMUSG00000034445

DomainStartEndE-ValueType
B561 46 175 1.47e-40 SMART
low complexity region 205 219 N/A INTRINSIC
Meta Mutation Damage Score 0.9659 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass transmembrane protein. Reduced expression of this gene in mouse fibroblasts causes short cilia and failure of ciliogenesis. Expression of this gene is tightly coordinated with expression of the neighboring gene TMEM216. Mutations in this gene are associated with the autosomal recessive neurodevelopmental disorder Joubert Syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A T 19: 8,740,784 D6V probably damaging Het
2310057M21Rik G T 7: 131,357,613 H165Q probably damaging Het
Akap13 T A 7: 75,677,416 F721Y probably damaging Het
Akap6 A T 12: 53,140,354 D1517V probably damaging Het
Amigo3 T A 9: 108,053,728 S117T probably damaging Het
Atf7ip2 T A 16: 10,201,411 N34K probably damaging Het
Cacnb1 A C 11: 98,005,782 V351G probably damaging Het
Casp9 T A 4: 141,805,349 probably null Het
Ccdc51 C T 9: 109,089,415 T24I probably benign Het
Cdh23 T A 10: 60,434,512 Y618F probably damaging Het
Chd1 T A 17: 15,758,688 W1271R probably damaging Het
Dars T C 1: 128,368,439 T386A probably benign Het
Dchs1 T A 7: 105,765,106 D834V probably damaging Het
Dgkd T A 1: 87,936,381 V933E possibly damaging Het
Dnah17 A G 11: 118,025,654 F4203S probably damaging Het
Fancm T C 12: 65,130,382 L2000P probably damaging Het
Fbxo11 A T 17: 88,008,669 H444Q probably benign Het
Fbxw14 T A 9: 109,276,222 T292S probably damaging Het
Fer1l6 T C 15: 58,559,206 S237P probably damaging Het
Frem3 T C 8: 80,615,047 I1323T probably benign Het
Grin2a A G 16: 9,653,449 F652L probably benign Het
Grin2b T A 6: 135,923,458 M142L possibly damaging Het
Helz A G 11: 107,619,060 Q503R possibly damaging Het
Ighv5-17 A G 12: 113,859,295 Y69H probably benign Het
Il17ra A G 6: 120,475,582 N242S probably benign Het
Immp1l G C 2: 105,964,208 G117A probably damaging Het
Itm2c T C 1: 85,894,692 V10A probably benign Het
Kif1b T C 4: 149,238,426 K679E possibly damaging Het
Kng1 T C 16: 23,074,645 V256A possibly damaging Het
Lamc2 T G 1: 153,166,153 R78S possibly damaging Het
Loxl4 A G 19: 42,598,793 F621S probably damaging Het
Lpl T A 8: 68,892,747 D134E probably damaging Het
Lypd3 T C 7: 24,640,494 Y329H probably benign Het
Mettl13 T C 1: 162,535,886 D225G probably benign Het
Myo7b A G 18: 31,999,974 F441L probably damaging Het
Nnt T A 13: 119,336,328 M699L possibly damaging Het
Nr1h3 A T 2: 91,191,851 M144K probably damaging Het
Olfr1040 A G 2: 86,145,969 V255A probably benign Het
Olfr1347 T C 7: 6,488,845 T3A probably benign Het
Olfr325 A T 11: 58,581,068 M75L probably benign Het
Pappa2 A T 1: 158,871,543 Y667N probably damaging Het
Prps1l3 A G 12: 57,238,888 I155V probably benign Het
Ptgs2 T A 1: 150,100,993 N24K probably benign Het
Ralgds A T 2: 28,547,588 M514L probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Sacm1l T A 9: 123,569,005 V254D probably damaging Het
Selenot A T 3: 58,585,284 Q64L probably damaging Het
Sgsm2 G A 11: 74,850,851 R1037W probably damaging Het
Slc22a12 A G 19: 6,542,724 V10A probably benign Het
Spem2 G T 11: 69,816,696 S481* probably null Het
Styk1 C T 6: 131,311,016 G128D probably damaging Het
Tmc6 A T 11: 117,776,328 L148Q probably damaging Het
Tnpo3 A G 6: 29,555,268 V772A probably benign Het
Topaz1 T C 9: 122,797,756 F1483S possibly damaging Het
Tuba4a C A 1: 75,216,055 C305F probably damaging Het
Ubap1 T G 4: 41,379,262 F159V possibly damaging Het
Vmn2r9 A G 5: 108,849,016 I129T probably benign Het
Wwc2 A T 8: 47,856,263 M828K unknown Het
Zfp236 A T 18: 82,671,794 S187T possibly damaging Het
Other mutations in Tmem138
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01993:Tmem138 APN 19 10571588 missense probably benign
R0103:Tmem138 UTSW 19 10574952 missense possibly damaging 0.49
R0103:Tmem138 UTSW 19 10574952 missense possibly damaging 0.49
R0384:Tmem138 UTSW 19 10574822 unclassified probably benign
R2259:Tmem138 UTSW 19 10571603 missense probably benign 0.13
R2436:Tmem138 UTSW 19 10574904 missense probably damaging 1.00
R5176:Tmem138 UTSW 19 10575270 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGGTGAACTTATCATGGTCCTC -3'
(R):5'- TGTCTACAGCATCCAGGATATTGC -3'

Sequencing Primer
(F):5'- TGTGTAGATCCAGCATGACC -3'
(R):5'- GCATCCAGGATATTGCAATCC -3'
Posted On2017-10-10