Incidental Mutation 'R6138:6820408C15Rik'
ID488441
Institutional Source Beutler Lab
Gene Symbol 6820408C15Rik
Ensembl Gene ENSMUSG00000032680
Gene NameRIKEN cDNA 6820408C15 gene
Synonyms
MMRRC Submission 044285-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6138 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location152415587-152444330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 152440870 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 215 (V215A)
Ref Sequence ENSEMBL: ENSMUSP00000037024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039961] [ENSMUST00000128737] [ENSMUST00000153713]
Predicted Effect probably damaging
Transcript: ENSMUST00000039961
AA Change: V215A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037024
Gene: ENSMUSG00000032680
AA Change: V215A

DomainStartEndE-ValueType
Pfam:DUF4618 96 353 4.1e-105 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128737
SMART Domains Protein: ENSMUSP00000117627
Gene: ENSMUSG00000032680

DomainStartEndE-ValueType
Pfam:DUF4618 97 158 1.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153713
SMART Domains Protein: ENSMUSP00000120724
Gene: ENSMUSG00000032680

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Meta Mutation Damage Score 0.3694 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Abhd14a A T 9: 106,443,866 S97T possibly damaging Het
Adamts2 T A 11: 50,756,706 I302N probably damaging Het
Adgra2 G A 8: 27,114,429 A511T probably damaging Het
Akap9 T C 5: 4,067,924 probably null Het
Ccr6 G A 17: 8,256,382 V140I probably damaging Het
Dlat A T 9: 50,645,117 probably null Het
Gcg A G 2: 62,475,804 S150P probably damaging Het
Gk5 C T 9: 96,176,237 Q424* probably null Het
Gm13103 T G 4: 143,851,585 H87Q possibly damaging Het
Insm2 T C 12: 55,600,014 I181T probably damaging Het
Itgae A G 11: 73,115,574 E356G possibly damaging Het
Kitl G A 10: 100,076,906 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Myo3b T C 2: 70,238,899 V494A possibly damaging Het
Myo7a C T 7: 98,065,790 W1558* probably null Het
Olfr356 G A 2: 36,937,229 V37I probably benign Het
Olfr510 T A 7: 108,668,205 V263E probably damaging Het
Pgk1 C A X: 106,194,492 L85I possibly damaging Het
Pik3c2b G A 1: 133,074,627 probably null Het
Plagl1 G A 10: 13,127,746 G253R probably damaging Het
Ppp4r1 G A 17: 65,814,348 V268I possibly damaging Het
Satl1 T C X: 112,405,916 T281A probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Synrg A G 11: 84,024,300 E1044G probably damaging Het
Tbx5 T C 5: 119,883,146 S406P probably benign Het
Theg A G 10: 79,584,755 S159P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Other mutations in 6820408C15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:6820408C15Rik APN 2 152442387 missense possibly damaging 0.89
IGL01986:6820408C15Rik APN 2 152441036 missense possibly damaging 0.84
IGL02153:6820408C15Rik APN 2 152441241 missense probably benign 0.06
IGL02178:6820408C15Rik APN 2 152428001 splice site probably benign
IGL03339:6820408C15Rik APN 2 152442456 missense probably damaging 1.00
R0468:6820408C15Rik UTSW 2 152441266 missense probably benign 0.01
R1624:6820408C15Rik UTSW 2 152434111 missense probably damaging 0.98
R1642:6820408C15Rik UTSW 2 152440854 missense probably damaging 1.00
R2420:6820408C15Rik UTSW 2 152429001 missense probably damaging 1.00
R3109:6820408C15Rik UTSW 2 152442456 missense probably damaging 1.00
R3153:6820408C15Rik UTSW 2 152440824 missense probably damaging 1.00
R3154:6820408C15Rik UTSW 2 152440824 missense probably damaging 1.00
R3875:6820408C15Rik UTSW 2 152434080 missense probably benign
R4237:6820408C15Rik UTSW 2 152428953 missense possibly damaging 0.46
R4746:6820408C15Rik UTSW 2 152440765 missense probably benign 0.13
R4957:6820408C15Rik UTSW 2 152444093 missense probably damaging 1.00
R4959:6820408C15Rik UTSW 2 152440888 missense possibly damaging 0.90
R4973:6820408C15Rik UTSW 2 152440888 missense possibly damaging 0.90
R5261:6820408C15Rik UTSW 2 152440857 missense probably damaging 1.00
R5399:6820408C15Rik UTSW 2 152440868 missense probably damaging 1.00
R5971:6820408C15Rik UTSW 2 152440870 missense probably damaging 1.00
R6223:6820408C15Rik UTSW 2 152427953 missense probably benign 0.00
R6379:6820408C15Rik UTSW 2 152427992 missense probably benign 0.01
R6642:6820408C15Rik UTSW 2 152440870 missense probably damaging 1.00
R6815:6820408C15Rik UTSW 2 152441055 missense probably benign 0.29
R8083:6820408C15Rik UTSW 2 152441067 missense possibly damaging 0.94
U15987:6820408C15Rik UTSW 2 152440870 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCTGAAAGAAGCCCCAG -3'
(R):5'- ACGACCAGAGACTTCAGGATTTTC -3'

Sequencing Primer
(F):5'- TCTGAAAGAAGCCCCAGACATCTG -3'
(R):5'- CAGAGACTTCAGGATTTTCTTCTTC -3'
Posted On2017-10-10