Incidental Mutation 'R6138:Shroom3'
ID 488444
Institutional Source Beutler Lab
Gene Symbol Shroom3
Ensembl Gene ENSMUSG00000029381
Gene Name shroom family member 3
Synonyms Shrm3, D5Ertd287e, Shrm
MMRRC Submission 044285-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6138 (G1)
Quality Score 199.009
Status Validated
Chromosome 5
Chromosomal Location 92831294-93113177 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 93090945 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 1151 (V1151F)
Ref Sequence ENSEMBL: ENSMUSP00000153516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113051] [ENSMUST00000113054] [ENSMUST00000113055] [ENSMUST00000168878] [ENSMUST00000172706] [ENSMUST00000225438]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000113051
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108674
Gene: ENSMUSG00000029381
AA Change: V1057F

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
Pfam:ASD1 706 885 2.3e-65 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 1132 1143 N/A INTRINSIC
low complexity region 1172 1184 N/A INTRINSIC
low complexity region 1274 1288 N/A INTRINSIC
low complexity region 1333 1345 N/A INTRINSIC
Pfam:ASD2 1478 1765 3.1e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113054
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108677
Gene: ENSMUSG00000029381
AA Change: V1057F

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
Pfam:ASD1 706 885 2.3e-65 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 1132 1143 N/A INTRINSIC
low complexity region 1172 1184 N/A INTRINSIC
low complexity region 1274 1288 N/A INTRINSIC
low complexity region 1333 1345 N/A INTRINSIC
Pfam:ASD2 1478 1765 3.1e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113055
AA Change: V1232F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: V1232F

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
Pfam:ASD1 882 1060 1e-57 PFAM
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1307 1318 N/A INTRINSIC
low complexity region 1347 1359 N/A INTRINSIC
low complexity region 1449 1463 N/A INTRINSIC
low complexity region 1508 1520 N/A INTRINSIC
Pfam:ASD2 1654 1940 9.9e-112 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000168878
AA Change: V1101F
SMART Domains Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: V1101F

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
low complexity region 1176 1187 N/A INTRINSIC
low complexity region 1216 1228 N/A INTRINSIC
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1377 1389 N/A INTRINSIC
Pfam:ASD2 1522 1809 8.9e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172706
SMART Domains Protein: ENSMUSP00000133690
Gene: ENSMUSG00000029381

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201800
Predicted Effect probably damaging
Transcript: ENSMUST00000225438
AA Change: V1151F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,684,980 (GRCm39) C172* probably null Het
6820408C15Rik T C 2: 152,282,790 (GRCm39) V215A probably damaging Het
Abhd14a A T 9: 106,321,065 (GRCm39) S97T possibly damaging Het
Adamts2 T A 11: 50,647,533 (GRCm39) I302N probably damaging Het
Adgra2 G A 8: 27,604,457 (GRCm39) A511T probably damaging Het
Akap9 T C 5: 4,117,924 (GRCm39) probably null Het
Ccr6 G A 17: 8,475,214 (GRCm39) V140I probably damaging Het
Dlat A T 9: 50,556,417 (GRCm39) probably null Het
Gcg A G 2: 62,306,148 (GRCm39) S150P probably damaging Het
Gk5 C T 9: 96,058,290 (GRCm39) Q424* probably null Het
Insm2 T C 12: 55,646,799 (GRCm39) I181T probably damaging Het
Itgae A G 11: 73,006,400 (GRCm39) E356G possibly damaging Het
Kitl G A 10: 99,912,768 (GRCm39) probably null Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Myo3b T C 2: 70,069,243 (GRCm39) V494A possibly damaging Het
Myo7a C T 7: 97,714,997 (GRCm39) W1558* probably null Het
Or1ak2 G A 2: 36,827,241 (GRCm39) V37I probably benign Het
Or5p81 T A 7: 108,267,412 (GRCm39) V263E probably damaging Het
Pgk1 C A X: 105,238,098 (GRCm39) L85I possibly damaging Het
Pik3c2b G A 1: 133,002,365 (GRCm39) probably null Het
Plagl1 G A 10: 13,003,490 (GRCm39) G253R probably damaging Het
Ppp4r1 G A 17: 66,121,343 (GRCm39) V268I possibly damaging Het
Pramel27 T G 4: 143,578,155 (GRCm39) H87Q possibly damaging Het
Satl1 T C X: 111,315,613 (GRCm39) T281A probably benign Het
Spmap2 A G 10: 79,420,589 (GRCm39) S159P probably damaging Het
Synrg A G 11: 83,915,126 (GRCm39) E1044G probably damaging Het
Tbx5 T C 5: 120,021,211 (GRCm39) S406P probably benign Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Vmn2r79 T A 7: 86,653,319 (GRCm39) V528D possibly damaging Het
Other mutations in Shroom3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Shroom3 APN 5 93,098,924 (GRCm39) missense probably damaging 1.00
IGL01086:Shroom3 APN 5 93,096,311 (GRCm39) missense probably benign 0.01
IGL01363:Shroom3 APN 5 93,088,852 (GRCm39) missense probably benign 0.01
IGL01468:Shroom3 APN 5 93,088,201 (GRCm39) missense probably damaging 1.00
IGL01675:Shroom3 APN 5 93,089,539 (GRCm39) missense probably damaging 0.99
IGL01862:Shroom3 APN 5 93,110,148 (GRCm39) missense probably damaging 1.00
IGL01987:Shroom3 APN 5 93,090,048 (GRCm39) missense probably damaging 0.99
IGL02104:Shroom3 APN 5 93,088,248 (GRCm39) missense probably benign 0.32
IGL03248:Shroom3 APN 5 93,100,399 (GRCm39) missense probably benign 0.00
IGL03386:Shroom3 APN 5 93,096,342 (GRCm39) splice site probably benign
R0167:Shroom3 UTSW 5 93,096,254 (GRCm39) splice site probably benign
R0388:Shroom3 UTSW 5 93,099,152 (GRCm39) missense probably benign 0.39
R0395:Shroom3 UTSW 5 92,928,762 (GRCm39) missense probably damaging 1.00
R0567:Shroom3 UTSW 5 93,112,312 (GRCm39) missense possibly damaging 0.53
R1496:Shroom3 UTSW 5 93,090,693 (GRCm39) missense possibly damaging 0.69
R1772:Shroom3 UTSW 5 93,088,515 (GRCm39) missense probably damaging 0.97
R1845:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R1921:Shroom3 UTSW 5 93,110,224 (GRCm39) critical splice donor site probably null
R2059:Shroom3 UTSW 5 92,831,643 (GRCm39) missense probably damaging 1.00
R2203:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2204:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2205:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2301:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2344:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2345:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2346:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2348:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2371:Shroom3 UTSW 5 92,928,729 (GRCm39) missense probably damaging 1.00
R2435:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2829:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2830:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2831:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2897:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2898:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3079:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3080:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3433:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3729:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3730:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3735:Shroom3 UTSW 5 93,112,303 (GRCm39) missense possibly damaging 0.84
R3736:Shroom3 UTSW 5 93,112,303 (GRCm39) missense possibly damaging 0.84
R3851:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3852:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3943:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3969:Shroom3 UTSW 5 93,088,738 (GRCm39) missense probably benign 0.05
R4008:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4009:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4012:Shroom3 UTSW 5 93,096,342 (GRCm39) splice site probably benign
R4154:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4157:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4172:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4173:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4201:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4202:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4204:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4205:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4206:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4284:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4285:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4364:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4384:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4456:Shroom3 UTSW 5 93,088,858 (GRCm39) missense probably benign 0.14
R4707:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4712:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4751:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4755:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4760:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4773:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4774:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4776:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4801:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4802:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4856:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4857:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4860:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4860:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4882:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4883:Shroom3 UTSW 5 93,098,993 (GRCm39) missense probably benign 0.14
R4886:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R5262:Shroom3 UTSW 5 93,112,432 (GRCm39) missense probably damaging 1.00
R5271:Shroom3 UTSW 5 93,110,107 (GRCm39) missense probably damaging 1.00
R5719:Shroom3 UTSW 5 93,090,877 (GRCm39) missense probably benign 0.04
R5726:Shroom3 UTSW 5 93,090,864 (GRCm39) missense probably benign 0.00
R5993:Shroom3 UTSW 5 93,088,047 (GRCm39) missense probably damaging 1.00
R6078:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R6079:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R6153:Shroom3 UTSW 5 93,112,267 (GRCm39) missense probably damaging 0.99
R6493:Shroom3 UTSW 5 93,089,420 (GRCm39) missense probably benign 0.03
R6495:Shroom3 UTSW 5 93,089,928 (GRCm39) missense possibly damaging 0.66
R6693:Shroom3 UTSW 5 93,088,617 (GRCm39) missense possibly damaging 0.61
R6801:Shroom3 UTSW 5 93,088,795 (GRCm39) missense probably damaging 1.00
R6893:Shroom3 UTSW 5 93,090,063 (GRCm39) missense probably damaging 0.97
R6912:Shroom3 UTSW 5 93,090,876 (GRCm39) missense probably benign 0.02
R6924:Shroom3 UTSW 5 93,112,262 (GRCm39) missense probably damaging 1.00
R7083:Shroom3 UTSW 5 93,112,384 (GRCm39) missense probably damaging 1.00
R7197:Shroom3 UTSW 5 93,090,463 (GRCm39) missense probably damaging 1.00
R7366:Shroom3 UTSW 5 93,112,465 (GRCm39) nonsense probably null
R7712:Shroom3 UTSW 5 93,098,806 (GRCm39) missense probably benign 0.01
R7725:Shroom3 UTSW 5 93,089,512 (GRCm39) missense probably benign 0.19
R7728:Shroom3 UTSW 5 92,831,566 (GRCm39) missense possibly damaging 0.73
R7774:Shroom3 UTSW 5 93,098,348 (GRCm39) missense probably damaging 0.98
R7795:Shroom3 UTSW 5 93,067,508 (GRCm39) missense probably damaging 0.99
R7821:Shroom3 UTSW 5 93,088,705 (GRCm39) missense probably damaging 0.98
R7971:Shroom3 UTSW 5 93,098,933 (GRCm39) missense probably damaging 1.00
R8276:Shroom3 UTSW 5 93,088,339 (GRCm39) missense probably damaging 0.99
R8934:Shroom3 UTSW 5 93,089,584 (GRCm39) missense probably damaging 1.00
R8938:Shroom3 UTSW 5 93,090,930 (GRCm39) missense probably damaging 1.00
R9083:Shroom3 UTSW 5 93,098,533 (GRCm39) missense probably damaging 0.97
R9108:Shroom3 UTSW 5 93,087,975 (GRCm39) missense probably damaging 1.00
R9124:Shroom3 UTSW 5 93,112,401 (GRCm39) missense probably benign 0.19
R9295:Shroom3 UTSW 5 93,098,478 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGAGCACACTCATCCGTC -3'
(R):5'- TTAACTGTCAGAACGGTAACCAACC -3'

Sequencing Primer
(F):5'- GTGATCGCAGCAGCTCCTTC -3'
(R):5'- AGACATTTATATATCTTTGTGCGGG -3'
Posted On 2017-10-10