Mutagenetix > Incidental Mutations

Incidental Mutation 'R0525:Abca16'

48845

Institutional Source

Beutler Lab

Gene Symbol

Abca16

Ensembl Gene

ENSMUSG00000051900

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 16

Synonyms

MMRRC Submission

038718-MU

Accession Numbers

NCBI RefSeq: NM_001278943.1, NM_001278944.1; MGI:2388711

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0525 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

120409647-120544813 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to G at 120465810 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 563 (Y563*)

Ref Sequence

ENSEMBL: ENSMUSP00000112736 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056042] [ENSMUST00000120490]

AlphaFold

E9PWJ7

Predicted Effect

probably null
Transcript: ENSMUST00000056042
AA Change: Y562*

SMART Domains

Protein: ENSMUSP00000061094
Gene: ENSMUSG00000051900
AA Change: Y562*

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	26	455	2.7e-23	PFAM
AAA	537	720	2.01e-7	SMART
Pfam:ABC2_membrane_3	898	1287	4.6e-25	PFAM
low complexity region	1325	1336	N/A	INTRINSIC
low complexity region	1342	1353	N/A	INTRINSIC
AAA	1378	1563	4.23e-6	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000120490
AA Change: Y563*

SMART Domains

Protein: ENSMUSP00000112736
Gene: ENSMUSG00000051900
AA Change: Y563*

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	25	456	2.4e-22	PFAM
AAA	538	721	2.01e-7	SMART
Pfam:ABC2_membrane_3	899	1288	1.1e-27	PFAM
low complexity region	1326	1337	N/A	INTRINSIC
low complexity region	1343	1354	N/A	INTRINSIC
AAA	1379	1564	4.23e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144122

SMART Domains

Protein: ENSMUSP00000114975
Gene: ENSMUSG00000051900

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	2	133	1e-16	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.8%

Validation Efficiency

100% (72/72)

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933440M02Rik	T	A	7: 125,331,499		noncoding transcript	Het
A930002H24Rik	A	G	17: 63,863,647	W49R	unknown	Het
Abca13	G	A	11: 9,293,371	V1745M	probably damaging	Het
Acot12	C	T	13: 91,760,067		probably benign	Het
Alms1	G	A	6: 85,587,760	A39T	unknown	Het
Arid5b	T	C	10: 68,097,846	D742G	possibly damaging	Het
Atp1a4	G	A	1: 172,239,688		probably benign	Het
AU021092	T	A	16: 5,217,861	E145V	possibly damaging	Het
Calr4	A	T	4: 109,242,264		probably benign	Het
Clip4	T	A	17: 71,799,098		probably null	Het
Cnpy4	A	T	5: 138,192,616	H180L	probably benign	Het
Cyp2j9	T	C	4: 96,579,565		probably null	Het
Dgkq	A	G	5: 108,654,615	S406P	probably damaging	Het
Dhx8	G	A	11: 101,763,928	C1014Y	probably damaging	Het
Dnah3	T	C	7: 119,928,754	Y3824C	probably damaging	Het
Donson	A	T	16: 91,686,245	H69Q	probably damaging	Het
Dppa3	A	G	6: 122,629,980	E143G	probably damaging	Het
Drg1	A	G	11: 3,262,545	F96L	probably damaging	Het
Dvl1	A	C	4: 155,855,595	T395P	probably damaging	Het
Eftud2	A	T	11: 102,839,253	V897D	probably damaging	Het
Enpp6	A	G	8: 47,082,443	N341S	possibly damaging	Het
F11	A	G	8: 45,253,049	F100L	probably benign	Het
Fas	T	C	19: 34,319,327	Y189H	probably damaging	Het
Galnt14	G	T	17: 73,545,081	S114R	probably damaging	Het
Gfpt2	A	G	11: 49,829,775	I528V	probably benign	Het
Glt6d1	A	G	2: 25,794,268	V242A	possibly damaging	Het
Grm1	A	T	10: 10,719,209		probably benign	Het
Gskip	G	A	12: 105,698,965	A88T	probably damaging	Het
Gtpbp1	A	G	15: 79,713,447	I348V	probably benign	Het
Hnrnpul1	C	A	7: 25,740,883	R316L	possibly damaging	Het
Il34	T	C	8: 110,748,283	E121G	probably damaging	Het
Lrr1	T	C	12: 69,168,911	L19P	probably damaging	Het
Mat2b	A	G	11: 40,682,669		probably benign	Het
Mettl21e	T	C	1: 44,206,382	K235E	probably damaging	Het
Mir124-2hg	T	A	3: 17,785,529	E126V	possibly damaging	Het
Myh15	A	G	16: 49,132,051	K828R	probably benign	Het
Myom3	A	G	4: 135,764,926	D127G	possibly damaging	Het
Nek5	C	A	8: 22,079,077		probably benign	Het
Nudt7	A	T	8: 114,151,652		probably null	Het
Olfr1056	C	T	2: 86,356,275	V36I	probably benign	Het
Olfr1118	A	T	2: 87,309,349	T187S	probably benign	Het
Olfr1200	G	A	2: 88,767,314	Q334*	probably null	Het
Olfr350	T	C	2: 36,850,190	L48P	probably damaging	Het
Olfr961	T	G	9: 39,647,471	C248W	probably damaging	Het
Phyhd1	A	G	2: 30,281,028	H241R	probably damaging	Het
Pmch	T	C	10: 88,091,400		probably benign	Het
Ror1	A	G	4: 100,441,520	S697G	probably damaging	Het
Rslcan18	A	G	13: 67,112,258	V25A	probably benign	Het
Sema6b	T	C	17: 56,126,630	H426R	probably damaging	Het
Serpina3g	T	C	12: 104,238,339	F9S	probably damaging	Het
Serpinb12	T	A	1: 106,946,702	H52Q	probably benign	Het
Sh3gl1	T	C	17: 56,017,873	K294R	probably benign	Het
Sidt1	G	T	16: 44,259,446	T615K	possibly damaging	Het
Slc16a4	A	C	3: 107,297,939		probably benign	Het
Sned1	T	A	1: 93,271,974		probably null	Het
Sp2	A	T	11: 96,956,098		probably benign	Het
Steap1	T	A	5: 5,742,903	I3F	possibly damaging	Het
Stxbp5l	A	T	16: 37,129,797		probably null	Het
Tbc1d9	G	T	8: 83,268,985	V968F	probably benign	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Triobp	T	C	15: 78,973,898	L1233P	possibly damaging	Het
Trp53bp1	C	A	2: 121,251,868	A317S	probably null	Het
Trpc4ap	A	G	2: 155,640,478	F531L	possibly damaging	Het
Ugt1a10	C	T	1: 88,218,249	P473L	probably damaging	Het
Vmn1r86	T	C	7: 13,102,161	K213E	probably benign	Het
Vps8	G	A	16: 21,540,109		probably null	Het
Wnk1	A	T	6: 119,926,564	S2563T	probably damaging	Het
Yrdc	C	G	4: 124,851,766	R3G	probably damaging	Het
Zfp287	A	T	11: 62,715,244	V279E	probably benign	Het

Other mutations in Abca16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Abca16	APN	7	120423759	missense	probably benign	0.08
IGL00590:Abca16	APN	7	120423815	missense	probably damaging	1.00
IGL01320:Abca16	APN	7	120439199	missense	probably damaging	1.00
IGL01322:Abca16	APN	7	120439199	missense	probably damaging	1.00
IGL01613:Abca16	APN	7	120541277	missense	probably benign	0.03
IGL01774:Abca16	APN	7	120477835	missense	probably damaging	1.00
IGL01774:Abca16	APN	7	120421801	splice site	probably benign
IGL01797:Abca16	APN	7	120514537	missense	probably benign	0.15
IGL02406:Abca16	APN	7	120540602	missense	probably damaging	1.00
IGL02437:Abca16	APN	7	120533729	missense	probably benign	0.00
IGL02541:Abca16	APN	7	120514658	missense	possibly damaging	0.91
IGL02576:Abca16	APN	7	120433455	missense	probably benign	0.05
IGL02578:Abca16	APN	7	120423956	critical splice donor site	probably null
IGL03156:Abca16	APN	7	120423851	missense	possibly damaging	0.69
IGL03381:Abca16	APN	7	120527818	missense	probably benign	0.12
PIT4802001:Abca16	UTSW	7	120540128	missense	probably benign	0.31
R0024:Abca16	UTSW	7	120433385	missense	probably damaging	1.00
R0026:Abca16	UTSW	7	120477923	splice site	probably benign
R0026:Abca16	UTSW	7	120477923	splice site	probably benign
R0123:Abca16	UTSW	7	120540155	missense	probably damaging	1.00
R0134:Abca16	UTSW	7	120540155	missense	probably damaging	1.00
R0225:Abca16	UTSW	7	120540155	missense	probably damaging	1.00
R0346:Abca16	UTSW	7	120435932	missense	probably damaging	1.00
R0355:Abca16	UTSW	7	120423798	missense	possibly damaging	0.68
R0358:Abca16	UTSW	7	120544716	missense	probably benign	0.01
R0617:Abca16	UTSW	7	120433611	splice site	probably benign
R0625:Abca16	UTSW	7	120435893	missense	probably damaging	1.00
R0835:Abca16	UTSW	7	120465784	missense	probably benign	0.42
R1445:Abca16	UTSW	7	120520033	missense	probably benign	0.41
R1535:Abca16	UTSW	7	120540705	missense	probably benign	0.30
R1567:Abca16	UTSW	7	120431129	missense	probably benign	0.08
R1694:Abca16	UTSW	7	120520084	missense	probably damaging	1.00
R1860:Abca16	UTSW	7	120534763	missense	probably benign	0.02
R1876:Abca16	UTSW	7	120433385	missense	probably damaging	1.00
R1913:Abca16	UTSW	7	120541240	missense	probably benign	0.04
R1940:Abca16	UTSW	7	120433609	splice site	probably benign
R2042:Abca16	UTSW	7	120544718	missense	probably benign
R2115:Abca16	UTSW	7	120540645	missense	probably damaging	1.00
R2122:Abca16	UTSW	7	120519961	missense	probably damaging	1.00
R2265:Abca16	UTSW	7	120431160	missense	probably benign	0.03
R2267:Abca16	UTSW	7	120431160	missense	probably benign	0.03
R2269:Abca16	UTSW	7	120431160	missense	probably benign	0.03
R2993:Abca16	UTSW	7	120535161	missense	probably damaging	1.00
R3055:Abca16	UTSW	7	120435851	missense	probably benign	0.05
R3956:Abca16	UTSW	7	120527752	missense	probably damaging	0.96
R4114:Abca16	UTSW	7	120527067	missense	probably benign	0.06
R4441:Abca16	UTSW	7	120527801	missense	probably benign	0.04
R4601:Abca16	UTSW	7	120436697	missense	probably damaging	0.98
R4706:Abca16	UTSW	7	120465765	missense	probably damaging	1.00
R4807:Abca16	UTSW	7	120540609	missense	probably damaging	1.00
R4824:Abca16	UTSW	7	120475479	missense	possibly damaging	0.86
R4937:Abca16	UTSW	7	120527086	missense	probably damaging	0.98
R5152:Abca16	UTSW	7	120540623	missense	probably benign	0.02
R5257:Abca16	UTSW	7	120436769	critical splice donor site	probably null
R5258:Abca16	UTSW	7	120436769	critical splice donor site	probably null
R5330:Abca16	UTSW	7	120503377	missense	probably benign	0.15
R5388:Abca16	UTSW	7	120540746	critical splice donor site	probably null
R5590:Abca16	UTSW	7	120544772	missense	probably damaging	0.98
R5810:Abca16	UTSW	7	120435932	missense	probably damaging	1.00
R6030:Abca16	UTSW	7	120533798	missense	probably benign
R6030:Abca16	UTSW	7	120533798	missense	probably benign
R6161:Abca16	UTSW	7	120540711	missense	probably damaging	1.00
R6313:Abca16	UTSW	7	120527121	missense	probably damaging	1.00
R6485:Abca16	UTSW	7	120427167	nonsense	probably null
R6527:Abca16	UTSW	7	120477772	missense	possibly damaging	0.95
R6772:Abca16	UTSW	7	120527053	missense	probably damaging	1.00
R6885:Abca16	UTSW	7	120520109	missense	probably benign	0.07
R6899:Abca16	UTSW	7	120527041	missense	probably damaging	1.00
R6941:Abca16	UTSW	7	120541147	missense	probably damaging	1.00
R6990:Abca16	UTSW	7	120527727	missense	probably benign	0.00
R7059:Abca16	UTSW	7	120421748	missense	probably benign	0.00
R7144:Abca16	UTSW	7	120433573	missense	possibly damaging	0.89
R7146:Abca16	UTSW	7	120527751	missense	possibly damaging	0.46
R7193:Abca16	UTSW	7	120427186	missense	probably damaging	1.00
R7308:Abca16	UTSW	7	120423770	missense	probably benign	0.01
R7449:Abca16	UTSW	7	120435908	missense	possibly damaging	0.95
R7571:Abca16	UTSW	7	120519988	missense	probably benign	0.11
R7617:Abca16	UTSW	7	120503471	nonsense	probably null
R7646:Abca16	UTSW	7	120514714	missense	probably benign	0.04
R7750:Abca16	UTSW	7	120514705	missense	probably benign	0.09
R7763:Abca16	UTSW	7	120514602	missense	probably damaging	1.00
R7840:Abca16	UTSW	7	120475466	missense	probably benign	0.00
R7946:Abca16	UTSW	7	120527175	missense	probably benign	0.01
R8018:Abca16	UTSW	7	120533643	missense	probably benign	0.04
R8170:Abca16	UTSW	7	120465782	missense	probably damaging	1.00
R8413:Abca16	UTSW	7	120423900	missense	probably benign	0.06
R8461:Abca16	UTSW	7	120436695	missense	possibly damaging	0.95
R8858:Abca16	UTSW	7	120453104	missense	probably benign
R8881:Abca16	UTSW	7	120475571	missense	probably benign	0.18
RF020:Abca16	UTSW	7	120533657	missense	possibly damaging	0.90
X0066:Abca16	UTSW	7	120503386	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCAGGCTGAGCCCATTTCTGGATA -3'
(R):5'- GCATTTCCTCTGGATTGGTACAACCTTT -3'

Sequencing Primer
(F):5'- GAGTTTCCTTTGGACCTAACAAC -3'
(R):5'- gtctcctactgctgcctttg -3'

Protein Function and Prediction

Abca16 encodes ABCA16, a member of the ATP-binding cassette (ABC) transporter superfamily. The members of the ABCA subfamily share a high degree of sequence conservation and function in lipid trafficking in several body locations [reviewed in (1)]. Abca16 has been cloned rat and mouse; no human orthologue has been described (2). The ABCA16 has two nucleotide-binding folds and two transmembrane domains (2). Abca16 is predominantly expressed in testis, indicating that it may function in testicular development or spermatogenesis (2).

References

1. Albrecht, C., and Viturro, E. (2007) The ABCA Subfamily--Gene and Protein Structures, Functions and Associated Hereditary Diseases. Pflugers Arch. 453, 581-589.

2. Chen, Z. Q., Annilo, T., Shulenin, S., and Dean, M. (2004) Three ATP-Binding Cassette Transporter Genes, Abca14, Abca15, and Abca16, Form a Cluster on Mouse Chromosome 7F3. Mamm Genome. 15, 335-343.

Posted On

2013-06-12

Science Writer

Anne Murray