Incidental Mutation 'R6138:Theg'
ID488453
Institutional Source Beutler Lab
Gene Symbol Theg
Ensembl Gene ENSMUSG00000020317
Gene Nametesticular haploid expressed gene
Synonyms
MMRRC Submission 044285-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6138 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location79576379-79587331 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79584755 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 159 (S159P)
Ref Sequence ENSEMBL: ENSMUSP00000076647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020566] [ENSMUST00000077433]
Predicted Effect probably damaging
Transcript: ENSMUST00000020566
AA Change: S183P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020566
Gene: ENSMUSG00000020317
AA Change: S183P

DomainStartEndE-ValueType
THEG 9 28 1.68e2 SMART
low complexity region 58 73 N/A INTRINSIC
THEG 110 129 2.22e-2 SMART
THEG 176 195 4.69e-1 SMART
THEG 214 233 9.16e-4 SMART
THEG 250 269 7.22e-2 SMART
THEG 282 301 2.31e0 SMART
THEG 318 337 4.45e-2 SMART
THEG 352 371 1.96e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077433
AA Change: S159P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076647
Gene: ENSMUSG00000020317
AA Change: S159P

DomainStartEndE-ValueType
THEG 9 28 6.2e-1 SMART
low complexity region 58 73 N/A INTRINSIC
THEG 110 129 7.8e-5 SMART
THEG 152 171 1.7e-3 SMART
THEG 190 209 3.3e-6 SMART
THEG 226 245 2.5e-4 SMART
THEG 258 277 8.3e-3 SMART
THEG 294 313 1.6e-4 SMART
THEG 328 347 7e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159782
Meta Mutation Damage Score 0.1892 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is specifically expressed in the nucleus of haploid male germ cells. The orthologous gene in mice encodes a protein that may play a role in protein assembly through interactions with T-complex protein 1 subunit epsilon. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Males homozygotes for a transgenic insertional mutation are sterile due to a block in spermiogenesis. Testis weights are reduced, and mutants exhibit multiple abnormalities in elongated spermatids in the seminiferous tubule lumen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
6820408C15Rik T C 2: 152,440,870 V215A probably damaging Het
Abhd14a A T 9: 106,443,866 S97T possibly damaging Het
Adamts2 T A 11: 50,756,706 I302N probably damaging Het
Adgra2 G A 8: 27,114,429 A511T probably damaging Het
Akap9 T C 5: 4,067,924 probably null Het
Ccr6 G A 17: 8,256,382 V140I probably damaging Het
Dlat A T 9: 50,645,117 probably null Het
Gcg A G 2: 62,475,804 S150P probably damaging Het
Gk5 C T 9: 96,176,237 Q424* probably null Het
Gm13103 T G 4: 143,851,585 H87Q possibly damaging Het
Insm2 T C 12: 55,600,014 I181T probably damaging Het
Itgae A G 11: 73,115,574 E356G possibly damaging Het
Kitl G A 10: 100,076,906 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Myo3b T C 2: 70,238,899 V494A possibly damaging Het
Myo7a C T 7: 98,065,790 W1558* probably null Het
Olfr356 G A 2: 36,937,229 V37I probably benign Het
Olfr510 T A 7: 108,668,205 V263E probably damaging Het
Pgk1 C A X: 106,194,492 L85I possibly damaging Het
Pik3c2b G A 1: 133,074,627 probably null Het
Plagl1 G A 10: 13,127,746 G253R probably damaging Het
Ppp4r1 G A 17: 65,814,348 V268I possibly damaging Het
Satl1 T C X: 112,405,916 T281A probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Synrg A G 11: 84,024,300 E1044G probably damaging Het
Tbx5 T C 5: 119,883,146 S406P probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Other mutations in Theg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Theg APN 10 79576599 missense probably damaging 0.99
IGL02013:Theg APN 10 79579935 splice site probably null
R0087:Theg UTSW 10 79585951 nonsense probably null
R1035:Theg UTSW 10 79583850 missense probably damaging 1.00
R4133:Theg UTSW 10 79580050 missense probably damaging 0.97
R5960:Theg UTSW 10 79585931 missense possibly damaging 0.76
R5971:Theg UTSW 10 79584755 missense probably damaging 1.00
R6067:Theg UTSW 10 79584755 missense probably damaging 1.00
R6357:Theg UTSW 10 79586955 missense probably benign 0.28
R7046:Theg UTSW 10 79586962 missense probably benign 0.35
R7117:Theg UTSW 10 79584907 intron probably null
R7463:Theg UTSW 10 79576715 missense probably damaging 0.99
U15987:Theg UTSW 10 79584755 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGACTGCTAAGGGACATTGG -3'
(R):5'- GCCTCTTAGGTTTAACCATGGGG -3'

Sequencing Primer
(F):5'- GACATTGGCTAGACCTCTTGAGAC -3'
(R):5'- GGAAGGAGCCAGTCTTGTC -3'
Posted On2017-10-10