Incidental Mutation 'R6138:Kitl'
ID 488454
Institutional Source Beutler Lab
Gene Symbol Kitl
Ensembl Gene ENSMUSG00000019966
Gene Name kit ligand
Synonyms blz, Mgf, SLF, SF, Kitlg, Steel factor, stem cell factor, Steel, Sl, SCF, Gb, grizzle-belly
MMRRC Submission 044285-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.205) question?
Stock # R6138 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 99851492-99936278 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 99912768 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000100920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020129] [ENSMUST00000105283] [ENSMUST00000130190] [ENSMUST00000218200]
AlphaFold P20826
Predicted Effect probably null
Transcript: ENSMUST00000020129
SMART Domains Protein: ENSMUSP00000020129
Gene: ENSMUSG00000019966

DomainStartEndE-ValueType
Pfam:SCF 1 176 5.7e-102 PFAM
Pfam:SCF 173 245 1.7e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105283
SMART Domains Protein: ENSMUSP00000100920
Gene: ENSMUSG00000019966

DomainStartEndE-ValueType
Pfam:SCF 1 273 2.3e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130190
SMART Domains Protein: ENSMUSP00000123360
Gene: ENSMUSG00000019966

DomainStartEndE-ValueType
Pfam:SCF 43 160 1.1e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218200
Meta Mutation Damage Score 0.9479 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the ligand of the tyrosine-kinase receptor encoded by the KIT locus. This ligand is a pleiotropic factor that acts in utero in germ cell and neural cell development, and hematopoiesis, all believed to reflect a role in cell migration. In adults, it functions pleiotropically, while mostly noted for its continued requirement in hematopoiesis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene affect migration of embryonic stem cells and cause similar phenotypes to mutations in its receptor gene (Kit). Mutants show mild to severe defects in pigmentation, hemopoiesis and reproduction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,684,980 (GRCm39) C172* probably null Het
6820408C15Rik T C 2: 152,282,790 (GRCm39) V215A probably damaging Het
Abhd14a A T 9: 106,321,065 (GRCm39) S97T possibly damaging Het
Adamts2 T A 11: 50,647,533 (GRCm39) I302N probably damaging Het
Adgra2 G A 8: 27,604,457 (GRCm39) A511T probably damaging Het
Akap9 T C 5: 4,117,924 (GRCm39) probably null Het
Ccr6 G A 17: 8,475,214 (GRCm39) V140I probably damaging Het
Dlat A T 9: 50,556,417 (GRCm39) probably null Het
Gcg A G 2: 62,306,148 (GRCm39) S150P probably damaging Het
Gk5 C T 9: 96,058,290 (GRCm39) Q424* probably null Het
Insm2 T C 12: 55,646,799 (GRCm39) I181T probably damaging Het
Itgae A G 11: 73,006,400 (GRCm39) E356G possibly damaging Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Myo3b T C 2: 70,069,243 (GRCm39) V494A possibly damaging Het
Myo7a C T 7: 97,714,997 (GRCm39) W1558* probably null Het
Or1ak2 G A 2: 36,827,241 (GRCm39) V37I probably benign Het
Or5p81 T A 7: 108,267,412 (GRCm39) V263E probably damaging Het
Pgk1 C A X: 105,238,098 (GRCm39) L85I possibly damaging Het
Pik3c2b G A 1: 133,002,365 (GRCm39) probably null Het
Plagl1 G A 10: 13,003,490 (GRCm39) G253R probably damaging Het
Ppp4r1 G A 17: 66,121,343 (GRCm39) V268I possibly damaging Het
Pramel27 T G 4: 143,578,155 (GRCm39) H87Q possibly damaging Het
Satl1 T C X: 111,315,613 (GRCm39) T281A probably benign Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Spmap2 A G 10: 79,420,589 (GRCm39) S159P probably damaging Het
Synrg A G 11: 83,915,126 (GRCm39) E1044G probably damaging Het
Tbx5 T C 5: 120,021,211 (GRCm39) S406P probably benign Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Vmn2r79 T A 7: 86,653,319 (GRCm39) V528D possibly damaging Het
Other mutations in Kitl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Kitl APN 10 99,923,206 (GRCm39) splice site probably benign
IGL02066:Kitl APN 10 99,912,744 (GRCm39) missense probably damaging 1.00
IGL03211:Kitl APN 10 99,916,721 (GRCm39) missense probably benign 0.19
Gregory UTSW 10 99,912,768 (GRCm39) critical splice donor site probably null
mooyah UTSW 10 99,924,084 (GRCm39) critical splice donor site probably null
Sandycheeks UTSW 10 99,912,768 (GRCm39) critical splice donor site probably null
R0131:Kitl UTSW 10 99,923,226 (GRCm39) missense probably benign 0.11
R0131:Kitl UTSW 10 99,923,226 (GRCm39) missense probably benign 0.11
R0132:Kitl UTSW 10 99,923,226 (GRCm39) missense probably benign 0.11
R1554:Kitl UTSW 10 99,923,300 (GRCm39) missense probably benign 0.38
R1649:Kitl UTSW 10 99,899,976 (GRCm39) missense probably benign 0.03
R2194:Kitl UTSW 10 99,851,899 (GRCm39) critical splice donor site probably null
R2254:Kitl UTSW 10 99,915,993 (GRCm39) critical splice donor site probably null
R4877:Kitl UTSW 10 99,916,728 (GRCm39) missense probably damaging 1.00
R5135:Kitl UTSW 10 99,924,084 (GRCm39) critical splice donor site probably null
R5453:Kitl UTSW 10 99,923,247 (GRCm39) missense probably damaging 1.00
R5564:Kitl UTSW 10 99,915,886 (GRCm39) missense possibly damaging 0.89
R5832:Kitl UTSW 10 99,915,882 (GRCm39) missense probably damaging 1.00
R5971:Kitl UTSW 10 99,912,768 (GRCm39) critical splice donor site probably null
R6043:Kitl UTSW 10 99,899,947 (GRCm39) missense probably damaging 1.00
R6067:Kitl UTSW 10 99,912,768 (GRCm39) critical splice donor site probably null
R6255:Kitl UTSW 10 99,925,095 (GRCm39) makesense probably null
R6450:Kitl UTSW 10 99,923,256 (GRCm39) start codon destroyed probably null 0.00
R6588:Kitl UTSW 10 99,899,954 (GRCm39) missense probably damaging 1.00
R6951:Kitl UTSW 10 99,887,714 (GRCm39) missense probably damaging 1.00
R7315:Kitl UTSW 10 99,851,974 (GRCm39) missense unknown
R7368:Kitl UTSW 10 99,851,943 (GRCm39) missense probably benign 0.02
R8010:Kitl UTSW 10 99,887,765 (GRCm39) missense probably benign 0.22
R8234:Kitl UTSW 10 99,887,708 (GRCm39) missense probably damaging 1.00
R9613:Kitl UTSW 10 99,916,781 (GRCm39) missense probably damaging 1.00
U15987:Kitl UTSW 10 99,912,768 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTGCTGAGAGACTTGAAGAGCC -3'
(R):5'- GCCACTTCAGTATTGCAGTAAAAC -3'

Sequencing Primer
(F):5'- TTGAAGAGCCCCCTGAATCTG -3'
(R):5'- TGCAGTAAAACTACAATAGACTCTTG -3'
Posted On 2017-10-10