Incidental Mutation 'R6138:Insm2'
ID488459
Institutional Source Beutler Lab
Gene Symbol Insm2
Ensembl Gene ENSMUSG00000045440
Gene Nameinsulinoma-associated 2
Synonymsmlt 1
MMRRC Submission 044285-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R6138 (G1)
Quality Score167.009
Status Validated
Chromosome12
Chromosomal Location55599427-55602086 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55600014 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 181 (I181T)
Ref Sequence ENSEMBL: ENSMUSP00000061046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051857] [ENSMUST00000085385] [ENSMUST00000110687] [ENSMUST00000219432] [ENSMUST00000220367] [ENSMUST00000226244]
Predicted Effect probably damaging
Transcript: ENSMUST00000051857
AA Change: I181T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061046
Gene: ENSMUSG00000045440
AA Change: I181T

DomainStartEndE-ValueType
low complexity region 21 31 N/A INTRINSIC
low complexity region 61 78 N/A INTRINSIC
low complexity region 97 114 N/A INTRINSIC
low complexity region 119 136 N/A INTRINSIC
ZnF_C2H2 203 223 1.98e2 SMART
ZnF_C2H2 231 253 7.15e-2 SMART
low complexity region 341 349 N/A INTRINSIC
ZnF_C2H2 354 376 1.2e-3 SMART
ZnF_C2H2 398 420 1.02e1 SMART
low complexity region 433 448 N/A INTRINSIC
ZnF_C2H2 452 475 4.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085385
SMART Domains Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2003 7.4e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110687
SMART Domains Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2001 1.9e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219432
Predicted Effect probably benign
Transcript: ENSMUST00000219451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219516
Predicted Effect probably benign
Transcript: ENSMUST00000220367
Predicted Effect probably benign
Transcript: ENSMUST00000226244
Meta Mutation Damage Score 0.1899 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
6820408C15Rik T C 2: 152,440,870 V215A probably damaging Het
Abhd14a A T 9: 106,443,866 S97T possibly damaging Het
Adamts2 T A 11: 50,756,706 I302N probably damaging Het
Adgra2 G A 8: 27,114,429 A511T probably damaging Het
Akap9 T C 5: 4,067,924 probably null Het
Ccr6 G A 17: 8,256,382 V140I probably damaging Het
Dlat A T 9: 50,645,117 probably null Het
Gcg A G 2: 62,475,804 S150P probably damaging Het
Gk5 C T 9: 96,176,237 Q424* probably null Het
Gm13103 T G 4: 143,851,585 H87Q possibly damaging Het
Itgae A G 11: 73,115,574 E356G possibly damaging Het
Kitl G A 10: 100,076,906 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Myo3b T C 2: 70,238,899 V494A possibly damaging Het
Myo7a C T 7: 98,065,790 W1558* probably null Het
Olfr356 G A 2: 36,937,229 V37I probably benign Het
Olfr510 T A 7: 108,668,205 V263E probably damaging Het
Pgk1 C A X: 106,194,492 L85I possibly damaging Het
Pik3c2b G A 1: 133,074,627 probably null Het
Plagl1 G A 10: 13,127,746 G253R probably damaging Het
Ppp4r1 G A 17: 65,814,348 V268I possibly damaging Het
Satl1 T C X: 112,405,916 T281A probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Synrg A G 11: 84,024,300 E1044G probably damaging Het
Tbx5 T C 5: 119,883,146 S406P probably benign Het
Theg A G 10: 79,584,755 S159P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Other mutations in Insm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0646:Insm2 UTSW 12 55600440 missense probably benign 0.19
R1166:Insm2 UTSW 12 55600496 missense probably benign
R2508:Insm2 UTSW 12 55600311 missense probably benign 0.00
R3978:Insm2 UTSW 12 55600838 missense probably benign 0.00
R4716:Insm2 UTSW 12 55600892 missense possibly damaging 0.93
R4884:Insm2 UTSW 12 55599761 missense probably damaging 1.00
R5154:Insm2 UTSW 12 55600197 missense probably damaging 1.00
R6067:Insm2 UTSW 12 55600014 missense probably damaging 1.00
R6078:Insm2 UTSW 12 55600014 missense probably damaging 1.00
R6424:Insm2 UTSW 12 55600082 missense probably damaging 1.00
R6969:Insm2 UTSW 12 55600178 missense probably damaging 1.00
R7069:Insm2 UTSW 12 55599836 nonsense probably null
R7117:Insm2 UTSW 12 55600572 missense probably damaging 1.00
R7252:Insm2 UTSW 12 55600520 missense probably benign 0.00
R7289:Insm2 UTSW 12 55600544 missense probably damaging 0.99
U15987:Insm2 UTSW 12 55600014 missense probably damaging 1.00
Z1088:Insm2 UTSW 12 55599797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGGTGAAGCGAACCAAG -3'
(R):5'- TGAAGACCTTGTCGCACTCG -3'

Sequencing Primer
(F):5'- GGTCTCTGCGGAGTCCTTC -3'
(R):5'- ACTCGGGACAGCGGTACTC -3'
Posted On2017-10-10