Incidental Mutation 'R6138:Ccr6'
ID 488461
Institutional Source Beutler Lab
Gene Symbol Ccr6
Ensembl Gene ENSMUSG00000040899
Gene Name chemokine (C-C motif) receptor 6
Synonyms Cmkbr6
MMRRC Submission 044285-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6138 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 8236043-8257141 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 8256382 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 140 (V140I)
Ref Sequence ENSEMBL: ENSMUSP00000156324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097418] [ENSMUST00000164411] [ENSMUST00000166348] [ENSMUST00000167956] [ENSMUST00000177568] [ENSMUST00000180103] [ENSMUST00000231340] [ENSMUST00000231545]
AlphaFold O54689
Predicted Effect probably damaging
Transcript: ENSMUST00000097418
AA Change: V140I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095029
Gene: ENSMUSG00000040899
AA Change: V140I

DomainStartEndE-ValueType
Pfam:7tm_1 55 308 6.5e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164411
AA Change: V140I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131153
Gene: ENSMUSG00000040899
AA Change: V140I

DomainStartEndE-ValueType
Pfam:7tm_1 55 308 6.5e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166348
AA Change: V140I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128559
Gene: ENSMUSG00000040899
AA Change: V140I

DomainStartEndE-ValueType
Pfam:7tm_1 55 308 6.5e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167956
AA Change: V140I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128529
Gene: ENSMUSG00000040899
AA Change: V140I

DomainStartEndE-ValueType
Pfam:7tm_1 55 308 6.5e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177568
AA Change: V140I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137249
Gene: ENSMUSG00000040899
AA Change: V140I

DomainStartEndE-ValueType
Pfam:7tm_1 55 308 8.9e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180103
AA Change: V140I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135945
Gene: ENSMUSG00000040899
AA Change: V140I

DomainStartEndE-ValueType
Pfam:7tm_1 55 308 6.5e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231340
Predicted Effect probably damaging
Transcript: ENSMUST00000231545
AA Change: V140I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232412
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. The gene is preferentially expressed by immature dendritic cells and memory T cells. The ligand of this receptor is macrophage inflammatory protein 3 alpha (MIP-3 alpha). This receptor has been shown to be important for B-lineage maturation and antigen-driven B-cell differentiation, and it may regulate the migration and recruitment of dentritic and T cells during inflammatory and immunological responses. Alternatively spliced transcript variants that encode the same protein have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have decreased inflammatory responses, aberrant trafficking of lymphocytes and dendritic cells, and decreased expression of many inflammatory mediators. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
6820408C15Rik T C 2: 152,440,870 V215A probably damaging Het
Abhd14a A T 9: 106,443,866 S97T possibly damaging Het
Adamts2 T A 11: 50,756,706 I302N probably damaging Het
Adgra2 G A 8: 27,114,429 A511T probably damaging Het
Akap9 T C 5: 4,067,924 probably null Het
Dlat A T 9: 50,645,117 probably null Het
Gcg A G 2: 62,475,804 S150P probably damaging Het
Gk5 C T 9: 96,176,237 Q424* probably null Het
Gm13103 T G 4: 143,851,585 H87Q possibly damaging Het
Insm2 T C 12: 55,600,014 I181T probably damaging Het
Itgae A G 11: 73,115,574 E356G possibly damaging Het
Kitl G A 10: 100,076,906 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Myo3b T C 2: 70,238,899 V494A possibly damaging Het
Myo7a C T 7: 98,065,790 W1558* probably null Het
Olfr356 G A 2: 36,937,229 V37I probably benign Het
Olfr510 T A 7: 108,668,205 V263E probably damaging Het
Pgk1 C A X: 106,194,492 L85I possibly damaging Het
Pik3c2b G A 1: 133,074,627 probably null Het
Plagl1 G A 10: 13,127,746 G253R probably damaging Het
Ppp4r1 G A 17: 65,814,348 V268I possibly damaging Het
Satl1 T C X: 112,405,916 T281A probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Synrg A G 11: 84,024,300 E1044G probably damaging Het
Tbx5 T C 5: 119,883,146 S406P probably benign Het
Theg A G 10: 79,584,755 S159P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Other mutations in Ccr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Ccr6 APN 17 8255993 missense probably benign 0.07
IGL02227:Ccr6 APN 17 8256452 missense probably damaging 1.00
IGL02339:Ccr6 APN 17 8256253 missense probably benign 0.01
E0374:Ccr6 UTSW 17 8256452 missense probably damaging 1.00
R0021:Ccr6 UTSW 17 8256766 missense possibly damaging 0.46
R0976:Ccr6 UTSW 17 8256422 missense probably damaging 1.00
R0980:Ccr6 UTSW 17 8256014 missense probably benign 0.00
R1141:Ccr6 UTSW 17 8256002 missense probably damaging 1.00
R1674:Ccr6 UTSW 17 8256217 missense probably damaging 0.99
R2117:Ccr6 UTSW 17 8256082 missense possibly damaging 0.75
R2176:Ccr6 UTSW 17 8256241 missense probably damaging 0.99
R4736:Ccr6 UTSW 17 8256064 nonsense probably null
R5050:Ccr6 UTSW 17 8256104 missense probably damaging 1.00
R5786:Ccr6 UTSW 17 8256412 missense probably damaging 0.99
R6856:Ccr6 UTSW 17 8256049 missense probably benign 0.08
R6950:Ccr6 UTSW 17 8257066 makesense probably null
R7102:Ccr6 UTSW 17 8256187 missense probably benign 0.15
R7206:Ccr6 UTSW 17 8256949 missense probably benign
R7223:Ccr6 UTSW 17 8256140 missense probably damaging 1.00
R7323:Ccr6 UTSW 17 8256779 missense possibly damaging 0.88
R7737:Ccr6 UTSW 17 8245094 start gained probably benign
R7974:Ccr6 UTSW 17 8256224 missense probably damaging 1.00
R8145:Ccr6 UTSW 17 8256113 missense probably benign 0.16
R8699:Ccr6 UTSW 17 8256566 missense probably benign 0.20
R8738:Ccr6 UTSW 17 8256562 missense probably damaging 0.98
R8983:Ccr6 UTSW 17 8256046 missense probably damaging 1.00
R9242:Ccr6 UTSW 17 8256133 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGAAAGCCAGATCCATGACTG -3'
(R):5'- TGATGGGCTCTGAGACAGAC -3'

Sequencing Primer
(F):5'- GACTGACGTCTACCTGTTGAACATG -3'
(R):5'- TCTGAGACAGACCTGTACCGTG -3'
Posted On 2017-10-10