Mutagenetix > Incidental Mutation

Incidental Mutation 'R6138:Ccr6'

488461

Institutional Source

Beutler Lab

Gene Symbol

Ccr6

Ensembl Gene

ENSMUSG00000040899

Gene Name

C-C motif chemokine receptor 6

Synonyms

Cmkbr6

MMRRC Submission

044285-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6138 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

8454875-8475973 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 8475214 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 140 (V140I)

Ref Sequence

ENSEMBL: ENSMUSP00000156324 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097418] [ENSMUST00000164411] [ENSMUST00000166348] [ENSMUST00000167956] [ENSMUST00000177568] [ENSMUST00000180103] [ENSMUST00000231340] [ENSMUST00000231545]

AlphaFold

O54689

Predicted Effect

probably damaging
Transcript: ENSMUST00000097418
AA Change: V140I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095029
Gene: ENSMUSG00000040899
AA Change: V140I

Domain	Start	End	E-Value	Type
Pfam:7tm_1	55	308	6.5e-55	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000164411
AA Change: V140I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131153
Gene: ENSMUSG00000040899
AA Change: V140I

Domain	Start	End	E-Value	Type
Pfam:7tm_1	55	308	6.5e-55	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000166348
AA Change: V140I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128559
Gene: ENSMUSG00000040899
AA Change: V140I

Domain	Start	End	E-Value	Type
Pfam:7tm_1	55	308	6.5e-55	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000167956
AA Change: V140I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128529
Gene: ENSMUSG00000040899
AA Change: V140I

Domain	Start	End	E-Value	Type
Pfam:7tm_1	55	308	6.5e-55	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000177568
AA Change: V140I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000137249
Gene: ENSMUSG00000040899
AA Change: V140I

Domain	Start	End	E-Value	Type
Pfam:7tm_1	55	308	8.9e-50	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000180103
AA Change: V140I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135945
Gene: ENSMUSG00000040899
AA Change: V140I

Domain	Start	End	E-Value	Type
Pfam:7tm_1	55	308	6.5e-55	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000231340

Predicted Effect

probably damaging
Transcript: ENSMUST00000231545
AA Change: V140I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232412

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.9%

Validation Efficiency

100% (31/31)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. The gene is preferentially expressed by immature dendritic cells and memory T cells. The ligand of this receptor is macrophage inflammatory protein 3 alpha (MIP-3 alpha). This receptor has been shown to be important for B-lineage maturation and antigen-driven B-cell differentiation, and it may regulate the migration and recruitment of dentritic and T cells during inflammatory and immunological responses. Alternatively spliced transcript variants that encode the same protein have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have decreased inflammatory responses, aberrant trafficking of lymphocytes and dendritic cells, and decreased expression of many inflammatory mediators. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,684,980 (GRCm39)	C172*	probably null	Het
6820408C15Rik	T	C	2: 152,282,790 (GRCm39)	V215A	probably damaging	Het
Abhd14a	A	T	9: 106,321,065 (GRCm39)	S97T	possibly damaging	Het
Adamts2	T	A	11: 50,647,533 (GRCm39)	I302N	probably damaging	Het
Adgra2	G	A	8: 27,604,457 (GRCm39)	A511T	probably damaging	Het
Akap9	T	C	5: 4,117,924 (GRCm39)		probably null	Het
Dlat	A	T	9: 50,556,417 (GRCm39)		probably null	Het
Gcg	A	G	2: 62,306,148 (GRCm39)	S150P	probably damaging	Het
Gk5	C	T	9: 96,058,290 (GRCm39)	Q424*	probably null	Het
Insm2	T	C	12: 55,646,799 (GRCm39)	I181T	probably damaging	Het
Itgae	A	G	11: 73,006,400 (GRCm39)	E356G	possibly damaging	Het
Kitl	G	A	10: 99,912,768 (GRCm39)		probably null	Het
Lgr6	C	T	1: 134,921,748 (GRCm39)	A199T	probably damaging	Het
Myo3b	T	C	2: 70,069,243 (GRCm39)	V494A	possibly damaging	Het
Myo7a	C	T	7: 97,714,997 (GRCm39)	W1558*	probably null	Het
Or1ak2	G	A	2: 36,827,241 (GRCm39)	V37I	probably benign	Het
Or5p81	T	A	7: 108,267,412 (GRCm39)	V263E	probably damaging	Het
Pgk1	C	A	X: 105,238,098 (GRCm39)	L85I	possibly damaging	Het
Pik3c2b	G	A	1: 133,002,365 (GRCm39)		probably null	Het
Plagl1	G	A	10: 13,003,490 (GRCm39)	G253R	probably damaging	Het
Ppp4r1	G	A	17: 66,121,343 (GRCm39)	V268I	possibly damaging	Het
Pramel27	T	G	4: 143,578,155 (GRCm39)	H87Q	possibly damaging	Het
Satl1	T	C	X: 111,315,613 (GRCm39)	T281A	probably benign	Het
Shroom3	G	T	5: 93,090,945 (GRCm39)	V1151F	probably damaging	Het
Spmap2	A	G	10: 79,420,589 (GRCm39)	S159P	probably damaging	Het
Synrg	A	G	11: 83,915,126 (GRCm39)	E1044G	probably damaging	Het
Tbx5	T	C	5: 120,021,211 (GRCm39)	S406P	probably benign	Het
Tns2	C	T	15: 102,017,369 (GRCm39)	R281C	probably damaging	Het
Vmn2r79	T	A	7: 86,653,319 (GRCm39)	V528D	possibly damaging	Het

Other mutations in Ccr6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00927:Ccr6	APN	17	8,474,825 (GRCm39)	missense	probably benign	0.07
IGL02227:Ccr6	APN	17	8,475,284 (GRCm39)	missense	probably damaging	1.00
IGL02339:Ccr6	APN	17	8,475,085 (GRCm39)	missense	probably benign	0.01
E0374:Ccr6	UTSW	17	8,475,284 (GRCm39)	missense	probably damaging	1.00
R0021:Ccr6	UTSW	17	8,475,598 (GRCm39)	missense	possibly damaging	0.46
R0976:Ccr6	UTSW	17	8,475,254 (GRCm39)	missense	probably damaging	1.00
R0980:Ccr6	UTSW	17	8,474,846 (GRCm39)	missense	probably benign	0.00
R1141:Ccr6	UTSW	17	8,474,834 (GRCm39)	missense	probably damaging	1.00
R1674:Ccr6	UTSW	17	8,475,049 (GRCm39)	missense	probably damaging	0.99
R2117:Ccr6	UTSW	17	8,474,914 (GRCm39)	missense	possibly damaging	0.75
R2176:Ccr6	UTSW	17	8,475,073 (GRCm39)	missense	probably damaging	0.99
R4736:Ccr6	UTSW	17	8,474,896 (GRCm39)	nonsense	probably null
R5050:Ccr6	UTSW	17	8,474,936 (GRCm39)	missense	probably damaging	1.00
R5786:Ccr6	UTSW	17	8,475,244 (GRCm39)	missense	probably damaging	0.99
R6856:Ccr6	UTSW	17	8,474,881 (GRCm39)	missense	probably benign	0.08
R6950:Ccr6	UTSW	17	8,475,898 (GRCm39)	makesense	probably null
R7102:Ccr6	UTSW	17	8,475,019 (GRCm39)	missense	probably benign	0.15
R7206:Ccr6	UTSW	17	8,475,781 (GRCm39)	missense	probably benign
R7223:Ccr6	UTSW	17	8,474,972 (GRCm39)	missense	probably damaging	1.00
R7323:Ccr6	UTSW	17	8,475,611 (GRCm39)	missense	possibly damaging	0.88
R7737:Ccr6	UTSW	17	8,463,926 (GRCm39)	start gained	probably benign
R7974:Ccr6	UTSW	17	8,475,056 (GRCm39)	missense	probably damaging	1.00
R8145:Ccr6	UTSW	17	8,474,945 (GRCm39)	missense	probably benign	0.16
R8699:Ccr6	UTSW	17	8,475,398 (GRCm39)	missense	probably benign	0.20
R8738:Ccr6	UTSW	17	8,475,394 (GRCm39)	missense	probably damaging	0.98
R8983:Ccr6	UTSW	17	8,474,878 (GRCm39)	missense	probably damaging	1.00
R9242:Ccr6	UTSW	17	8,474,965 (GRCm39)	missense	probably benign	0.01
R9689:Ccr6	UTSW	17	8,475,821 (GRCm39)	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- AAGAAAGCCAGATCCATGACTG -3'
(R):5'- TGATGGGCTCTGAGACAGAC -3'

Sequencing Primer
(F):5'- GACTGACGTCTACCTGTTGAACATG -3'
(R):5'- TCTGAGACAGACCTGTACCGTG -3'

Posted On

2017-10-10