Incidental Mutation 'R6139:Cep350'
ID 488465
Institutional Source Beutler Lab
Gene Symbol Cep350
Ensembl Gene ENSMUSG00000033671
Gene Name centrosomal protein 350
Synonyms 4933409L06Rik, 6430546F08Rik
MMRRC Submission 044286-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.961) question?
Stock # R6139 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 155720710-155849001 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 155829025 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 293 (E293G)
Ref Sequence ENSEMBL: ENSMUSP00000120085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124495] [ENSMUST00000138762]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104231
Predicted Effect probably benign
Transcript: ENSMUST00000124495
AA Change: E233G

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000138762
AA Change: E293G

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000120085
Gene: ENSMUSG00000033671
AA Change: E293G

DomainStartEndE-ValueType
low complexity region 251 265 N/A INTRINSIC
low complexity region 376 394 N/A INTRINSIC
low complexity region 481 491 N/A INTRINSIC
coiled coil region 596 641 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 701 719 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 979 994 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1250 1267 N/A INTRINSIC
coiled coil region 1363 1402 N/A INTRINSIC
low complexity region 1517 1531 N/A INTRINSIC
low complexity region 1536 1546 N/A INTRINSIC
low complexity region 1694 1714 N/A INTRINSIC
coiled coil region 1732 1794 N/A INTRINSIC
low complexity region 1800 1811 N/A INTRINSIC
low complexity region 1819 1835 N/A INTRINSIC
coiled coil region 1853 1893 N/A INTRINSIC
low complexity region 1980 1994 N/A INTRINSIC
coiled coil region 2042 2092 N/A INTRINSIC
low complexity region 2383 2394 N/A INTRINSIC
low complexity region 2409 2421 N/A INTRINSIC
low complexity region 2470 2482 N/A INTRINSIC
CAP_GLY 2486 2551 5.91e-31 SMART
coiled coil region 2700 2731 N/A INTRINSIC
Meta Mutation Damage Score 0.0771 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a large protein with a CAP-Gly domain typically found in cytoskeleton-associated proteins. The encoded protein primarily localizes to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. The encoded protein directly interacts with another large centrosomal protein and is required to anchor microtubules at the centrosome. It is also implicated in the regulation of a class of nuclear hormone receptors in the nucleus. Several alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI

 All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A G 11: 117,697,150 (GRCm39) T250A probably damaging Het
Acacb T C 5: 114,350,713 (GRCm39) I1074T probably damaging Het
Acsl6 C A 11: 54,231,368 (GRCm39) P462T probably damaging Het
Aebp1 A G 11: 5,821,842 (GRCm39) D747G probably damaging Het
Antxr2 A C 5: 98,125,565 (GRCm39) probably null Het
Arhgap35 T C 7: 16,297,392 (GRCm39) T558A possibly damaging Het
Asap1 T A 15: 64,038,388 (GRCm39) I223F possibly damaging Het
C2cd5 A C 6: 142,980,784 (GRCm39) D669E probably damaging Het
Casz1 C T 4: 149,036,154 (GRCm39) T1472M probably damaging Het
Catsper4 A G 4: 133,945,177 (GRCm39) L154P probably damaging Het
Cma1 T A 14: 56,180,157 (GRCm39) probably null Het
Ddx42 C T 11: 106,130,843 (GRCm39) A439V probably damaging Het
Disp2 T A 2: 118,621,143 (GRCm39) L625Q probably damaging Het
Dnah1 T C 14: 31,007,984 (GRCm39) D2141G probably benign Het
Dsp T C 13: 38,376,382 (GRCm39) I1389T probably damaging Het
Fam81a A T 9: 70,010,100 (GRCm39) probably null Het
Fsip2 A G 2: 82,821,388 (GRCm39) D5707G possibly damaging Het
Gcnt4 G A 13: 97,083,360 (GRCm39) V219I probably benign Het
Gk2 A G 5: 97,604,139 (GRCm39) V233A probably benign Het
Grm1 T C 10: 10,622,075 (GRCm39) probably benign Het
Gsap T A 5: 21,486,538 (GRCm39) V649D probably damaging Het
Kif1b G A 4: 149,321,989 (GRCm39) H977Y possibly damaging Het
Ktn1 T A 14: 47,963,672 (GRCm39) probably null Het
Lgals12 T A 19: 7,581,742 (GRCm39) T29S probably benign Het
Me3 G T 7: 89,282,108 (GRCm39) probably benign Het
Mgst3 T G 1: 167,205,874 (GRCm39) K35T possibly damaging Het
Mtmr9 T C 14: 63,767,227 (GRCm39) R354G probably benign Het
Myh11 T C 16: 14,033,738 (GRCm39) E1059G probably damaging Het
Nr4a2 T A 2: 56,998,701 (GRCm39) H408L probably damaging Het
Or56b35 A T 7: 104,963,453 (GRCm39) T81S probably damaging Het
Or5ak23 A T 2: 85,244,690 (GRCm39) F178I probably damaging Het
Pds5b T A 5: 150,724,242 (GRCm39) L1275Q possibly damaging Het
Pfkfb4 A G 9: 108,856,825 (GRCm39) Y412C probably damaging Het
Pop1 T A 15: 34,529,204 (GRCm39) C745S probably benign Het
Ptpn14 T G 1: 189,583,362 (GRCm39) S736R probably benign Het
Rdh9 A T 10: 127,612,606 (GRCm39) T85S possibly damaging Het
Rnf223 T C 4: 156,217,260 (GRCm39) C212R probably damaging Het
Rnf39 A G 17: 37,254,230 (GRCm39) E84G probably damaging Het
Sfmbt1 T A 14: 30,533,375 (GRCm39) V584D probably damaging Het
Slc12a5 T A 2: 164,834,231 (GRCm39) S728T probably damaging Het
Slc16a12 T A 19: 34,648,295 (GRCm39) probably null Het
Snupn C A 9: 56,890,108 (GRCm39) Q310K possibly damaging Het
St7 T C 6: 17,694,353 (GRCm39) L48P probably damaging Het
Thsd7a T C 6: 12,379,572 (GRCm39) N951D possibly damaging Het
Ttn G A 2: 76,682,413 (GRCm39) R959* probably null Het
Ugt2b36 A T 5: 87,240,030 (GRCm39) D118E probably benign Het
Vmn2r7 G A 3: 64,623,339 (GRCm39) T327I probably damaging Het
Wdr70 T C 15: 8,108,735 (GRCm39) D137G probably benign Het
Wrn A T 8: 33,843,360 (GRCm39) M14K probably damaging Het
Xpot T A 10: 121,447,613 (GRCm39) E283V probably benign Het
Other mutations in Cep350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Cep350 APN 1 155,816,492 (GRCm39) missense possibly damaging 0.68
IGL00821:Cep350 APN 1 155,737,950 (GRCm39) missense probably benign
IGL00837:Cep350 APN 1 155,829,137 (GRCm39) missense probably damaging 1.00
IGL00977:Cep350 APN 1 155,808,611 (GRCm39) missense probably null 0.99
IGL01544:Cep350 APN 1 155,828,933 (GRCm39) missense probably damaging 1.00
IGL01616:Cep350 APN 1 155,828,993 (GRCm39) missense probably benign 0.00
IGL01695:Cep350 APN 1 155,819,904 (GRCm39) missense probably damaging 1.00
IGL01902:Cep350 APN 1 155,737,731 (GRCm39) missense probably damaging 1.00
IGL01977:Cep350 APN 1 155,787,714 (GRCm39) missense probably benign 0.01
IGL02388:Cep350 APN 1 155,829,499 (GRCm39) missense probably benign 0.28
IGL02475:Cep350 APN 1 155,738,341 (GRCm39) missense probably damaging 1.00
IGL02528:Cep350 APN 1 155,770,361 (GRCm39) missense probably damaging 1.00
IGL02598:Cep350 APN 1 155,738,713 (GRCm39) missense probably benign 0.00
IGL02676:Cep350 APN 1 155,737,977 (GRCm39) missense possibly damaging 0.82
IGL02728:Cep350 APN 1 155,828,968 (GRCm39) missense probably benign 0.02
IGL02744:Cep350 APN 1 155,807,279 (GRCm39) missense probably damaging 0.98
IGL02817:Cep350 APN 1 155,804,588 (GRCm39) missense probably damaging 1.00
IGL02892:Cep350 APN 1 155,744,552 (GRCm39) missense possibly damaging 0.51
IGL03156:Cep350 APN 1 155,733,788 (GRCm39) missense probably damaging 1.00
IGL03166:Cep350 APN 1 155,739,346 (GRCm39) missense possibly damaging 0.78
IGL03216:Cep350 APN 1 155,736,373 (GRCm39) missense probably benign 0.06
IGL03268:Cep350 APN 1 155,829,295 (GRCm39) missense probably benign 0.16
IGL03358:Cep350 APN 1 155,804,285 (GRCm39) missense probably benign
primed UTSW 1 155,829,334 (GRCm39) missense probably damaging 0.98
stoked UTSW 1 155,791,321 (GRCm39) missense probably benign 0.03
NA:Cep350 UTSW 1 155,834,394 (GRCm39) missense probably damaging 1.00
R0060:Cep350 UTSW 1 155,804,372 (GRCm39) missense probably damaging 1.00
R0060:Cep350 UTSW 1 155,804,372 (GRCm39) missense probably damaging 1.00
R0066:Cep350 UTSW 1 155,786,964 (GRCm39) missense probably damaging 0.99
R0066:Cep350 UTSW 1 155,786,964 (GRCm39) missense probably damaging 0.99
R0172:Cep350 UTSW 1 155,829,193 (GRCm39) missense probably benign 0.00
R0365:Cep350 UTSW 1 155,782,317 (GRCm39) missense probably benign 0.00
R0472:Cep350 UTSW 1 155,790,469 (GRCm39) missense probably damaging 0.99
R0502:Cep350 UTSW 1 155,776,629 (GRCm39) splice site probably null
R0538:Cep350 UTSW 1 155,724,366 (GRCm39) missense possibly damaging 0.80
R0547:Cep350 UTSW 1 155,777,181 (GRCm39) splice site probably null
R0565:Cep350 UTSW 1 155,836,941 (GRCm39) splice site probably benign
R0607:Cep350 UTSW 1 155,747,794 (GRCm39) missense probably damaging 1.00
R0645:Cep350 UTSW 1 155,816,458 (GRCm39) splice site probably null
R0675:Cep350 UTSW 1 155,835,499 (GRCm39) missense possibly damaging 0.63
R0828:Cep350 UTSW 1 155,828,992 (GRCm39) missense probably benign 0.00
R0863:Cep350 UTSW 1 155,737,981 (GRCm39) missense probably benign 0.00
R0969:Cep350 UTSW 1 155,816,572 (GRCm39) missense possibly damaging 0.81
R1102:Cep350 UTSW 1 155,807,264 (GRCm39) missense probably damaging 1.00
R1186:Cep350 UTSW 1 155,751,122 (GRCm39) missense probably damaging 1.00
R1552:Cep350 UTSW 1 155,786,484 (GRCm39) missense possibly damaging 0.92
R1560:Cep350 UTSW 1 155,804,825 (GRCm39) missense possibly damaging 0.48
R1698:Cep350 UTSW 1 155,829,104 (GRCm39) missense possibly damaging 0.62
R1729:Cep350 UTSW 1 155,787,727 (GRCm39) missense probably benign 0.17
R1735:Cep350 UTSW 1 155,828,960 (GRCm39) missense probably damaging 0.99
R1740:Cep350 UTSW 1 155,804,579 (GRCm39) missense probably damaging 1.00
R1783:Cep350 UTSW 1 155,804,611 (GRCm39) missense probably damaging 1.00
R1844:Cep350 UTSW 1 155,724,374 (GRCm39) missense probably damaging 0.99
R1848:Cep350 UTSW 1 155,829,397 (GRCm39) missense probably benign 0.28
R1988:Cep350 UTSW 1 155,808,850 (GRCm39) missense possibly damaging 0.82
R2008:Cep350 UTSW 1 155,790,467 (GRCm39) missense probably benign 0.16
R2241:Cep350 UTSW 1 155,834,302 (GRCm39) splice site probably null
R2245:Cep350 UTSW 1 155,754,766 (GRCm39) missense probably benign 0.10
R2402:Cep350 UTSW 1 155,738,882 (GRCm39) missense probably benign
R2566:Cep350 UTSW 1 155,835,464 (GRCm39) critical splice donor site probably null
R3160:Cep350 UTSW 1 155,738,910 (GRCm39) missense probably benign 0.00
R3162:Cep350 UTSW 1 155,738,910 (GRCm39) missense probably benign 0.00
R3769:Cep350 UTSW 1 155,828,950 (GRCm39) missense probably damaging 1.00
R4035:Cep350 UTSW 1 155,835,541 (GRCm39) missense probably benign 0.06
R4158:Cep350 UTSW 1 155,808,621 (GRCm39) missense probably damaging 1.00
R4160:Cep350 UTSW 1 155,808,621 (GRCm39) missense probably damaging 1.00
R4213:Cep350 UTSW 1 155,811,707 (GRCm39) missense probably damaging 1.00
R4483:Cep350 UTSW 1 155,802,214 (GRCm39) missense probably benign 0.01
R4648:Cep350 UTSW 1 155,778,344 (GRCm39) missense possibly damaging 0.85
R4694:Cep350 UTSW 1 155,804,332 (GRCm39) missense probably damaging 1.00
R4836:Cep350 UTSW 1 155,804,579 (GRCm39) missense probably damaging 1.00
R4839:Cep350 UTSW 1 155,804,240 (GRCm39) missense probably benign 0.00
R4969:Cep350 UTSW 1 155,736,025 (GRCm39) missense probably damaging 0.99
R5014:Cep350 UTSW 1 155,803,952 (GRCm39) missense probably benign 0.00
R5027:Cep350 UTSW 1 155,809,100 (GRCm39) missense probably benign 0.01
R5144:Cep350 UTSW 1 155,786,896 (GRCm39) missense probably damaging 0.99
R5153:Cep350 UTSW 1 155,811,692 (GRCm39) missense probably damaging 1.00
R5165:Cep350 UTSW 1 155,804,114 (GRCm39) missense probably damaging 1.00
R5182:Cep350 UTSW 1 155,733,854 (GRCm39) missense probably damaging 1.00
R5445:Cep350 UTSW 1 155,770,469 (GRCm39) missense probably benign 0.01
R5738:Cep350 UTSW 1 155,741,824 (GRCm39) missense probably damaging 1.00
R5809:Cep350 UTSW 1 155,809,087 (GRCm39) missense probably damaging 0.98
R5855:Cep350 UTSW 1 155,829,508 (GRCm39) missense probably benign 0.00
R6103:Cep350 UTSW 1 155,800,322 (GRCm39) missense probably benign 0.05
R6285:Cep350 UTSW 1 155,829,120 (GRCm39) missense possibly damaging 0.48
R6430:Cep350 UTSW 1 155,770,419 (GRCm39) missense probably damaging 1.00
R6446:Cep350 UTSW 1 155,737,900 (GRCm39) missense probably benign
R6520:Cep350 UTSW 1 155,809,082 (GRCm39) missense probably benign 0.02
R6712:Cep350 UTSW 1 155,733,852 (GRCm39) missense possibly damaging 0.93
R6940:Cep350 UTSW 1 155,804,297 (GRCm39) missense probably benign 0.01
R7020:Cep350 UTSW 1 155,804,077 (GRCm39) missense probably damaging 1.00
R7056:Cep350 UTSW 1 155,724,373 (GRCm39) missense probably damaging 1.00
R7141:Cep350 UTSW 1 155,790,494 (GRCm39) missense probably damaging 1.00
R7215:Cep350 UTSW 1 155,770,453 (GRCm39) missense possibly damaging 0.89
R7247:Cep350 UTSW 1 155,786,499 (GRCm39) missense probably damaging 1.00
R7272:Cep350 UTSW 1 155,829,334 (GRCm39) missense probably damaging 0.98
R7336:Cep350 UTSW 1 155,738,022 (GRCm39) missense probably benign 0.17
R7361:Cep350 UTSW 1 155,777,237 (GRCm39) missense probably damaging 1.00
R7390:Cep350 UTSW 1 155,741,833 (GRCm39) missense possibly damaging 0.94
R7402:Cep350 UTSW 1 155,803,961 (GRCm39) missense probably benign 0.00
R7428:Cep350 UTSW 1 155,770,365 (GRCm39) missense probably benign 0.00
R7440:Cep350 UTSW 1 155,816,518 (GRCm39) missense probably damaging 0.98
R7520:Cep350 UTSW 1 155,791,375 (GRCm39) missense probably benign 0.05
R7529:Cep350 UTSW 1 155,737,669 (GRCm39) missense probably benign 0.08
R7635:Cep350 UTSW 1 155,754,767 (GRCm39) nonsense probably null
R7806:Cep350 UTSW 1 155,737,809 (GRCm39) missense probably benign 0.00
R8100:Cep350 UTSW 1 155,829,148 (GRCm39) missense probably damaging 0.97
R8192:Cep350 UTSW 1 155,816,529 (GRCm39) missense possibly damaging 0.94
R8193:Cep350 UTSW 1 155,737,825 (GRCm39) missense probably benign 0.01
R8351:Cep350 UTSW 1 155,747,780 (GRCm39) missense probably damaging 0.99
R8406:Cep350 UTSW 1 155,798,164 (GRCm39) missense probably benign 0.00
R8451:Cep350 UTSW 1 155,747,780 (GRCm39) missense probably damaging 0.99
R8467:Cep350 UTSW 1 155,791,321 (GRCm39) missense probably benign 0.03
R8543:Cep350 UTSW 1 155,738,122 (GRCm39) missense probably damaging 0.98
R8714:Cep350 UTSW 1 155,736,477 (GRCm39) missense probably damaging 0.98
R8810:Cep350 UTSW 1 155,803,862 (GRCm39) missense probably damaging 1.00
R8837:Cep350 UTSW 1 155,737,518 (GRCm39) missense probably benign 0.09
R8933:Cep350 UTSW 1 155,739,161 (GRCm39) missense probably benign 0.01
R9043:Cep350 UTSW 1 155,773,228 (GRCm39) missense probably damaging 1.00
R9050:Cep350 UTSW 1 155,738,687 (GRCm39) missense possibly damaging 0.81
R9067:Cep350 UTSW 1 155,737,485 (GRCm39) missense probably benign 0.00
R9105:Cep350 UTSW 1 155,835,561 (GRCm39) missense probably damaging 1.00
R9295:Cep350 UTSW 1 155,738,051 (GRCm39) nonsense probably null
R9304:Cep350 UTSW 1 155,829,464 (GRCm39) missense probably damaging 0.98
R9456:Cep350 UTSW 1 155,744,457 (GRCm39) missense probably benign 0.00
R9575:Cep350 UTSW 1 155,751,113 (GRCm39) missense probably benign 0.03
R9715:Cep350 UTSW 1 155,751,107 (GRCm39) missense probably benign 0.00
R9749:Cep350 UTSW 1 155,828,985 (GRCm39) missense probably benign 0.02
R9758:Cep350 UTSW 1 155,770,433 (GRCm39) missense probably damaging 0.96
R9767:Cep350 UTSW 1 155,739,018 (GRCm39) missense probably benign 0.01
RF020:Cep350 UTSW 1 155,791,224 (GRCm39) missense probably benign 0.34
X0018:Cep350 UTSW 1 155,829,032 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ATGCAGCTAATTTGGTACTCAGC -3'
(R):5'- GTGAGAACAATTCAAAGCCTTCTC -3'

Sequencing Primer
(F):5'- GCAGCTAATTTGGTACTCAGCTGTTC -3'
(R):5'- TCAAAGCCTTCTCTTAACAACATGG -3'
Posted On 2017-10-10