Incidental Mutation 'R6139:Ptpn14'
ID488467
Institutional Source Beutler Lab
Gene Symbol Ptpn14
Ensembl Gene ENSMUSG00000026604
Gene Nameprotein tyrosine phosphatase, non-receptor type 14
SynonymsC130080N23Rik, PTP36, OTTMUSG00000022087
MMRRC Submission 044286-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6139 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location189728268-189876695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 189851165 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 736 (S736R)
Ref Sequence ENSEMBL: ENSMUSP00000095051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027898] [ENSMUST00000097442]
Predicted Effect probably benign
Transcript: ENSMUST00000027898
SMART Domains Protein: ENSMUSP00000027898
Gene: ENSMUSG00000026604

DomainStartEndE-ValueType
B41 17 220 3.7e-67 SMART
FERM_C 224 310 3.43e-15 SMART
low complexity region 565 575 N/A INTRINSIC
low complexity region 633 639 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
low complexity region 745 758 N/A INTRINSIC
low complexity region 817 834 N/A INTRINSIC
PTPc 910 1184 2.14e-103 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097442
AA Change: S736R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000095051
Gene: ENSMUSG00000026604
AA Change: S736R

DomainStartEndE-ValueType
B41 17 220 3.7e-67 SMART
FERM_C 224 310 3.43e-15 SMART
low complexity region 565 575 N/A INTRINSIC
low complexity region 633 639 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
low complexity region 745 758 N/A INTRINSIC
low complexity region 817 834 N/A INTRINSIC
PTPc 910 1184 2.14e-103 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195038
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal noncatalytic domain similar to that of band 4.1 superfamily cytoskeleton-associated proteins, which suggested the membrane or cytoskeleton localization of this protein. It appears to regulate lymphatic development in mammals, and a loss of function mutation has been found in a kindred with a lymphedema-choanal atresia. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit some postnatal growth retardation, decreased body weight, periorbital and limb edema, and lymphatic vessel hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A G 11: 117,806,324 T250A probably damaging Het
Acacb T C 5: 114,212,652 I1074T probably damaging Het
Acsl6 C A 11: 54,340,542 P462T probably damaging Het
Aebp1 A G 11: 5,871,842 D747G probably damaging Het
Antxr2 A C 5: 97,977,706 probably null Het
Arhgap35 T C 7: 16,563,467 T558A possibly damaging Het
Asap1 T A 15: 64,166,539 I223F possibly damaging Het
C2cd5 A C 6: 143,035,058 D669E probably damaging Het
Casz1 C T 4: 148,951,697 T1472M probably damaging Het
Catsper4 A G 4: 134,217,866 L154P probably damaging Het
Cep350 T C 1: 155,953,279 E293G probably benign Het
Cma1 T A 14: 55,942,700 probably null Het
Ddx42 C T 11: 106,240,017 A439V probably damaging Het
Disp2 T A 2: 118,790,662 L625Q probably damaging Het
Dnah1 T C 14: 31,286,027 D2141G probably benign Het
Dsp T C 13: 38,192,406 I1389T probably damaging Het
Fam81a A T 9: 70,102,818 probably null Het
Fsip2 A G 2: 82,991,044 D5707G possibly damaging Het
Gcnt4 G A 13: 96,946,852 V219I probably benign Het
Gk2 A G 5: 97,456,280 V233A probably benign Het
Grm1 T C 10: 10,746,331 probably benign Het
Gsap T A 5: 21,281,540 V649D probably damaging Het
Kif1b G A 4: 149,237,532 H977Y possibly damaging Het
Ktn1 T A 14: 47,726,215 probably null Het
Lgals12 T A 19: 7,604,377 T29S probably benign Het
Me3 G T 7: 89,632,900 probably benign Het
Mgst3 T G 1: 167,378,305 K35T possibly damaging Het
Mtmr9 T C 14: 63,529,778 R354G probably benign Het
Myh11 T C 16: 14,215,874 E1059G probably damaging Het
Nr4a2 T A 2: 57,108,689 H408L probably damaging Het
Olfr689 A T 7: 105,314,246 T81S probably damaging Het
Olfr993 A T 2: 85,414,346 F178I probably damaging Het
Pds5b T A 5: 150,800,777 L1275Q possibly damaging Het
Pfkfb4 A G 9: 109,027,757 Y412C probably damaging Het
Pop1 T A 15: 34,529,058 C745S probably benign Het
Rdh9 A T 10: 127,776,737 T85S possibly damaging Het
Rnf223 T C 4: 156,132,803 C212R probably damaging Het
Rnf39 A G 17: 36,943,338 E84G probably damaging Het
Sfmbt1 T A 14: 30,811,418 V584D probably damaging Het
Slc12a5 T A 2: 164,992,311 S728T probably damaging Het
Slc16a12 T A 19: 34,670,895 probably null Het
Snupn C A 9: 56,982,824 Q310K possibly damaging Het
St7 T C 6: 17,694,354 L48P probably damaging Het
Thsd7a T C 6: 12,379,573 N951D possibly damaging Het
Ttn G A 2: 76,852,069 R959* probably null Het
Ugt2b36 A T 5: 87,092,171 D118E probably benign Het
Vmn2r7 G A 3: 64,715,918 T327I probably damaging Het
Wdr70 T C 15: 8,079,251 D137G probably benign Het
Wrn A T 8: 33,353,332 M14K probably damaging Het
Xpot T A 10: 121,611,708 E283V probably benign Het
Other mutations in Ptpn14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Ptpn14 APN 1 189822633 missense probably damaging 1.00
IGL02501:Ptpn14 APN 1 189850390 missense probably benign 0.14
IGL03011:Ptpn14 APN 1 189839557 missense probably damaging 1.00
R0724:Ptpn14 UTSW 1 189850947 missense possibly damaging 0.52
R0791:Ptpn14 UTSW 1 189836440 splice site probably benign
R1363:Ptpn14 UTSW 1 189798628 missense probably damaging 1.00
R1605:Ptpn14 UTSW 1 189865512 missense probably benign 0.00
R1840:Ptpn14 UTSW 1 189786851 missense probably damaging 1.00
R1845:Ptpn14 UTSW 1 189839502 missense possibly damaging 0.96
R1891:Ptpn14 UTSW 1 189798653 missense probably damaging 1.00
R2187:Ptpn14 UTSW 1 189863228 nonsense probably null
R2288:Ptpn14 UTSW 1 189865498 missense probably damaging 1.00
R3686:Ptpn14 UTSW 1 189851399 missense probably damaging 1.00
R3895:Ptpn14 UTSW 1 189850546 missense probably benign 0.31
R3898:Ptpn14 UTSW 1 189850531 missense probably benign 0.35
R4004:Ptpn14 UTSW 1 189850510 missense probably benign 0.00
R4816:Ptpn14 UTSW 1 189856800 missense probably damaging 1.00
R4883:Ptpn14 UTSW 1 189850800 missense probably damaging 0.99
R4928:Ptpn14 UTSW 1 189822642 missense probably damaging 1.00
R4931:Ptpn14 UTSW 1 189851277 missense probably benign
R4957:Ptpn14 UTSW 1 189851272 missense probably benign 0.02
R5009:Ptpn14 UTSW 1 189850534 missense probably benign
R5038:Ptpn14 UTSW 1 189786886 missense probably damaging 1.00
R5264:Ptpn14 UTSW 1 189832800 critical splice donor site probably null
R5373:Ptpn14 UTSW 1 189850963 missense probably benign
R5441:Ptpn14 UTSW 1 189798570 missense probably damaging 1.00
R5540:Ptpn14 UTSW 1 189846364 missense probably benign 0.05
R5638:Ptpn14 UTSW 1 189786841 missense probably damaging 1.00
R5746:Ptpn14 UTSW 1 189846413 critical splice donor site probably null
R5872:Ptpn14 UTSW 1 189851032 missense probably benign 0.00
R5988:Ptpn14 UTSW 1 189850387 missense probably damaging 1.00
R6295:Ptpn14 UTSW 1 189850800 missense probably damaging 0.99
R6770:Ptpn14 UTSW 1 189832773 missense probably damaging 1.00
R7097:Ptpn14 UTSW 1 189863398 nonsense probably null
R7320:Ptpn14 UTSW 1 189832759 missense probably benign 0.11
R7324:Ptpn14 UTSW 1 189863424 missense possibly damaging 0.46
R7599:Ptpn14 UTSW 1 189850745 missense probably benign 0.39
R7699:Ptpn14 UTSW 1 189865411 missense probably benign 0.08
R7700:Ptpn14 UTSW 1 189865411 missense probably benign 0.08
Z1177:Ptpn14 UTSW 1 189860470 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAATATCCCCATGGCTCGC -3'
(R):5'- TAGGTCAGGCTCAGAGATGG -3'

Sequencing Primer
(F):5'- ATGGCTCGCCGCAACAC -3'
(R):5'- AGAGGCACCGTTGACAGC -3'
Posted On2017-10-10