Incidental Mutation 'R0525:Nek5'
ID48847
Institutional Source Beutler Lab
Gene Symbol Nek5
Ensembl Gene ENSMUSG00000037738
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 5
Synonyms
MMRRC Submission 038718-MU
Accession Numbers

Genbank: NM_177898.4; Ensembl: ENSMUST00000081815, ENSMUST00000169834

Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0525 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location22073616-22125053 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 22079077 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000169834] [ENSMUST00000209656]
Predicted Effect probably benign
Transcript: ENSMUST00000169834
SMART Domains Protein: ENSMUSP00000126705
Gene: ENSMUSG00000037738

DomainStartEndE-ValueType
S_TKc 4 255 3.77e-92 SMART
Blast:S_TKc 396 497 3e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000209656
Predicted Effect probably benign
Transcript: ENSMUST00000210824
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (72/72)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit progressive hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933440M02Rik T A 7: 125,331,499 noncoding transcript Het
A930002H24Rik A G 17: 63,863,647 W49R unknown Het
Abca13 G A 11: 9,293,371 V1745M probably damaging Het
Abca16 T G 7: 120,465,810 Y563* probably null Het
Acot12 C T 13: 91,760,067 probably benign Het
Alms1 G A 6: 85,587,760 A39T unknown Het
Arid5b T C 10: 68,097,846 D742G possibly damaging Het
Atp1a4 G A 1: 172,239,688 probably benign Het
AU021092 T A 16: 5,217,861 E145V possibly damaging Het
Calr4 A T 4: 109,242,264 probably benign Het
Clip4 T A 17: 71,799,098 probably null Het
Cnpy4 A T 5: 138,192,616 H180L probably benign Het
Cyp2j9 T C 4: 96,579,565 probably null Het
Dgkq A G 5: 108,654,615 S406P probably damaging Het
Dhx8 G A 11: 101,763,928 C1014Y probably damaging Het
Dnah3 T C 7: 119,928,754 Y3824C probably damaging Het
Donson A T 16: 91,686,245 H69Q probably damaging Het
Dppa3 A G 6: 122,629,980 E143G probably damaging Het
Drg1 A G 11: 3,262,545 F96L probably damaging Het
Dvl1 A C 4: 155,855,595 T395P probably damaging Het
Eftud2 A T 11: 102,839,253 V897D probably damaging Het
Enpp6 A G 8: 47,082,443 N341S possibly damaging Het
F11 A G 8: 45,253,049 F100L probably benign Het
Fas T C 19: 34,319,327 Y189H probably damaging Het
Galnt14 G T 17: 73,545,081 S114R probably damaging Het
Gfpt2 A G 11: 49,829,775 I528V probably benign Het
Glt6d1 A G 2: 25,794,268 V242A possibly damaging Het
Grm1 A T 10: 10,719,209 probably benign Het
Gskip G A 12: 105,698,965 A88T probably damaging Het
Gtpbp1 A G 15: 79,713,447 I348V probably benign Het
Hnrnpul1 C A 7: 25,740,883 R316L possibly damaging Het
Il34 T C 8: 110,748,283 E121G probably damaging Het
Lrr1 T C 12: 69,168,911 L19P probably damaging Het
Mat2b A G 11: 40,682,669 probably benign Het
Mettl21e T C 1: 44,206,382 K235E probably damaging Het
Mir124-2hg T A 3: 17,785,529 E126V possibly damaging Het
Myh15 A G 16: 49,132,051 K828R probably benign Het
Myom3 A G 4: 135,764,926 D127G possibly damaging Het
Nudt7 A T 8: 114,151,652 probably null Het
Olfr1056 C T 2: 86,356,275 V36I probably benign Het
Olfr1118 A T 2: 87,309,349 T187S probably benign Het
Olfr1200 G A 2: 88,767,314 Q334* probably null Het
Olfr350 T C 2: 36,850,190 L48P probably damaging Het
Olfr961 T G 9: 39,647,471 C248W probably damaging Het
Phyhd1 A G 2: 30,281,028 H241R probably damaging Het
Pmch T C 10: 88,091,400 probably benign Het
Ror1 A G 4: 100,441,520 S697G probably damaging Het
Rslcan18 A G 13: 67,112,258 V25A probably benign Het
Sema6b T C 17: 56,126,630 H426R probably damaging Het
Serpina3g T C 12: 104,238,339 F9S probably damaging Het
Serpinb12 T A 1: 106,946,702 H52Q probably benign Het
Sh3gl1 T C 17: 56,017,873 K294R probably benign Het
Sidt1 G T 16: 44,259,446 T615K possibly damaging Het
Slc16a4 A C 3: 107,297,939 probably benign Het
Sned1 T A 1: 93,271,974 probably null Het
Sp2 A T 11: 96,956,098 probably benign Het
Steap1 T A 5: 5,742,903 I3F possibly damaging Het
Stxbp5l A T 16: 37,129,797 probably null Het
Tbc1d9 G T 8: 83,268,985 V968F probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Triobp T C 15: 78,973,898 L1233P possibly damaging Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Trpc4ap A G 2: 155,640,478 F531L possibly damaging Het
Ugt1a10 C T 1: 88,218,249 P473L probably damaging Het
Vmn1r86 T C 7: 13,102,161 K213E probably benign Het
Vps8 G A 16: 21,540,109 probably null Het
Wnk1 A T 6: 119,926,564 S2563T probably damaging Het
Yrdc C G 4: 124,851,766 R3G probably damaging Het
Zfp287 A T 11: 62,715,244 V279E probably benign Het
Other mutations in Nek5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Nek5 APN 8 22111183 missense possibly damaging 0.75
IGL01418:Nek5 APN 8 22095269 missense probably damaging 1.00
IGL01485:Nek5 APN 8 22083369 missense probably benign 0.05
IGL01640:Nek5 APN 8 22120840 missense probably benign 0.00
IGL01894:Nek5 APN 8 22113819 missense probably damaging 1.00
IGL01958:Nek5 APN 8 22096826 missense probably benign 0.09
IGL02332:Nek5 APN 8 22095261 missense probably benign 0.14
IGL02718:Nek5 APN 8 22097463 missense probably benign 0.15
IGL03203:Nek5 APN 8 22118768 missense probably damaging 1.00
IGL03325:Nek5 APN 8 22079142 missense probably benign
R0257:Nek5 UTSW 8 22123672 intron probably benign
R0522:Nek5 UTSW 8 22088797 splice site probably benign
R1476:Nek5 UTSW 8 22096731 missense possibly damaging 0.86
R1483:Nek5 UTSW 8 22096790 missense probably benign 0.30
R1764:Nek5 UTSW 8 22109912 missense probably damaging 0.98
R1892:Nek5 UTSW 8 22107729 missense probably benign 0.11
R1989:Nek5 UTSW 8 22111169 missense probably damaging 1.00
R2229:Nek5 UTSW 8 22113632 missense possibly damaging 0.76
R4114:Nek5 UTSW 8 22111162 missense probably damaging 1.00
R4116:Nek5 UTSW 8 22111162 missense probably damaging 1.00
R4709:Nek5 UTSW 8 22083427 missense probably damaging 0.99
R4952:Nek5 UTSW 8 22079088 missense probably benign 0.00
R4952:Nek5 UTSW 8 22096799 missense probably benign 0.00
R5185:Nek5 UTSW 8 22083381 missense possibly damaging 0.78
R5816:Nek5 UTSW 8 22096736 missense probably benign 0.02
R5884:Nek5 UTSW 8 22088801 critical splice donor site probably null
R6009:Nek5 UTSW 8 22120822 missense probably benign 0.00
R6279:Nek5 UTSW 8 22107721 missense probably benign
R6300:Nek5 UTSW 8 22107721 missense probably benign
R6437:Nek5 UTSW 8 22085460 missense possibly damaging 0.95
R7034:Nek5 UTSW 8 22107723 missense probably benign 0.00
R7036:Nek5 UTSW 8 22107723 missense probably benign 0.00
R7278:Nek5 UTSW 8 22090484 missense probably benign 0.13
R7436:Nek5 UTSW 8 22108040 missense probably damaging 1.00
R7666:Nek5 UTSW 8 22090517 missense probably benign 0.12
R7827:Nek5 UTSW 8 22083387 missense possibly damaging 0.91
R8057:Nek5 UTSW 8 22088906 missense probably benign 0.21
R8350:Nek5 UTSW 8 22113672 missense probably damaging 0.98
R8847:Nek5 UTSW 8 22123579 missense probably benign 0.01
X0012:Nek5 UTSW 8 22095248 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACTGGCCTTGATCTTGCTTGTAGC -3'
(R):5'- TGCCATCATGAGTGGCATTCACAG -3'

Sequencing Primer
(F):5'- tgttagtacactgtagctgttttc -3'
(R):5'- TGGCATTCACAGTGGGATTG -3'
Posted On2013-06-12