Incidental Mutation 'R6139:Vmn2r7'
ID488474
Institutional Source Beutler Lab
Gene Symbol Vmn2r7
Ensembl Gene ENSMUSG00000116028
Gene Name
Synonyms
MMRRC Submission 044286-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R6139 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location64690660-64719602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 64715918 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 327 (T327I)
Ref Sequence ENSEMBL: ENSMUSP00000131220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161972] [ENSMUST00000168072]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000050123
Predicted Effect probably damaging
Transcript: ENSMUST00000161972
AA Change: T418I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124192
Gene: ENSMUSG00000062200
AA Change: T418I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 90 507 3.8e-77 PFAM
Pfam:NCD3G 549 602 3.4e-17 PFAM
Pfam:7tm_3 635 869 1.1e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168072
AA Change: T327I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131220
Gene: ENSMUSG00000116028
AA Change: T327I

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 5.1e-72 PFAM
Pfam:Peripla_BP_6 63 245 6.1e-10 PFAM
Pfam:NCD3G 458 511 1.8e-17 PFAM
Pfam:7tm_3 542 779 4.3e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177146
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A G 11: 117,806,324 T250A probably damaging Het
Acacb T C 5: 114,212,652 I1074T probably damaging Het
Acsl6 C A 11: 54,340,542 P462T probably damaging Het
Aebp1 A G 11: 5,871,842 D747G probably damaging Het
Antxr2 A C 5: 97,977,706 probably null Het
Arhgap35 T C 7: 16,563,467 T558A possibly damaging Het
Asap1 T A 15: 64,166,539 I223F possibly damaging Het
C2cd5 A C 6: 143,035,058 D669E probably damaging Het
Casz1 C T 4: 148,951,697 T1472M probably damaging Het
Catsper4 A G 4: 134,217,866 L154P probably damaging Het
Cep350 T C 1: 155,953,279 E293G probably benign Het
Cma1 T A 14: 55,942,700 probably null Het
Ddx42 C T 11: 106,240,017 A439V probably damaging Het
Disp2 T A 2: 118,790,662 L625Q probably damaging Het
Dnah1 T C 14: 31,286,027 D2141G probably benign Het
Dsp T C 13: 38,192,406 I1389T probably damaging Het
Fam81a A T 9: 70,102,818 probably null Het
Fsip2 A G 2: 82,991,044 D5707G possibly damaging Het
Gcnt4 G A 13: 96,946,852 V219I probably benign Het
Gk2 A G 5: 97,456,280 V233A probably benign Het
Grm1 T C 10: 10,746,331 probably benign Het
Gsap T A 5: 21,281,540 V649D probably damaging Het
Kif1b G A 4: 149,237,532 H977Y possibly damaging Het
Ktn1 T A 14: 47,726,215 probably null Het
Lgals12 T A 19: 7,604,377 T29S probably benign Het
Me3 G T 7: 89,632,900 probably benign Het
Mgst3 T G 1: 167,378,305 K35T possibly damaging Het
Mtmr9 T C 14: 63,529,778 R354G probably benign Het
Myh11 T C 16: 14,215,874 E1059G probably damaging Het
Nr4a2 T A 2: 57,108,689 H408L probably damaging Het
Olfr689 A T 7: 105,314,246 T81S probably damaging Het
Olfr993 A T 2: 85,414,346 F178I probably damaging Het
Pds5b T A 5: 150,800,777 L1275Q possibly damaging Het
Pfkfb4 A G 9: 109,027,757 Y412C probably damaging Het
Pop1 T A 15: 34,529,058 C745S probably benign Het
Ptpn14 T G 1: 189,851,165 S736R probably benign Het
Rdh9 A T 10: 127,776,737 T85S possibly damaging Het
Rnf223 T C 4: 156,132,803 C212R probably damaging Het
Rnf39 A G 17: 36,943,338 E84G probably damaging Het
Sfmbt1 T A 14: 30,811,418 V584D probably damaging Het
Slc12a5 T A 2: 164,992,311 S728T probably damaging Het
Slc16a12 T A 19: 34,670,895 probably null Het
Snupn C A 9: 56,982,824 Q310K possibly damaging Het
St7 T C 6: 17,694,354 L48P probably damaging Het
Thsd7a T C 6: 12,379,573 N951D possibly damaging Het
Ttn G A 2: 76,852,069 R959* probably null Het
Ugt2b36 A T 5: 87,092,171 D118E probably benign Het
Wdr70 T C 15: 8,079,251 D137G probably benign Het
Wrn A T 8: 33,353,332 M14K probably damaging Het
Xpot T A 10: 121,611,708 E283V probably benign Het
Other mutations in Vmn2r7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Vmn2r7 APN 3 64715813 missense possibly damaging 0.60
IGL01762:Vmn2r7 APN 3 64691435 missense probably benign 0.39
IGL01903:Vmn2r7 APN 3 64719443 missense probably benign 0.00
IGL02263:Vmn2r7 APN 3 64691447 missense probably damaging 1.00
IGL02458:Vmn2r7 APN 3 64693025 missense probably damaging 0.97
IGL02593:Vmn2r7 APN 3 64693022 missense probably damaging 1.00
IGL02797:Vmn2r7 APN 3 64691245 missense possibly damaging 0.80
IGL03047:Vmn2r7 UTSW 3 64707218 missense possibly damaging 0.81
PIT4504001:Vmn2r7 UTSW 3 64715976 missense probably benign 0.01
R0193:Vmn2r7 UTSW 3 64691039 missense probably damaging 1.00
R0329:Vmn2r7 UTSW 3 64691018 missense probably damaging 1.00
R0609:Vmn2r7 UTSW 3 64716479 missense probably benign 0.44
R0735:Vmn2r7 UTSW 3 64716367 missense probably benign 0.02
R0941:Vmn2r7 UTSW 3 64716579 missense probably benign
R1065:Vmn2r7 UTSW 3 64707138 missense possibly damaging 0.82
R1378:Vmn2r7 UTSW 3 64691604 missense possibly damaging 0.59
R1445:Vmn2r7 UTSW 3 64724802 missense probably benign 0.01
R1506:Vmn2r7 UTSW 3 64707079 missense probably benign
R1509:Vmn2r7 UTSW 3 64716460 nonsense probably null
R1519:Vmn2r7 UTSW 3 64716455 missense possibly damaging 0.95
R1706:Vmn2r7 UTSW 3 64691459 missense possibly damaging 0.79
R2113:Vmn2r7 UTSW 3 64691604 missense possibly damaging 0.59
R3725:Vmn2r7 UTSW 3 64724991 missense possibly damaging 0.65
R3874:Vmn2r7 UTSW 3 64719611 missense possibly damaging 0.69
R3902:Vmn2r7 UTSW 3 64719516 missense possibly damaging 0.46
R4084:Vmn2r7 UTSW 3 64692993 missense probably benign 0.08
R4117:Vmn2r7 UTSW 3 64715717 intron probably benign
R4333:Vmn2r7 UTSW 3 64690778 missense probably damaging 1.00
R4551:Vmn2r7 UTSW 3 64690689 missense possibly damaging 0.86
R4643:Vmn2r7 UTSW 3 64716404 missense probably damaging 1.00
R4654:Vmn2r7 UTSW 3 64719443 missense probably benign 0.00
R5091:Vmn2r7 UTSW 3 64690784 missense possibly damaging 0.63
R5109:Vmn2r7 UTSW 3 64690667 missense probably null 0.84
R5372:Vmn2r7 UTSW 3 64716324 missense probably damaging 1.00
R5415:Vmn2r7 UTSW 3 64716237 missense probably benign 0.07
R5740:Vmn2r7 UTSW 3 64707233 missense probably benign
R5977:Vmn2r7 UTSW 3 64716043 nonsense probably null
R6019:Vmn2r7 UTSW 3 64716222 missense probably damaging 1.00
R6058:Vmn2r7 UTSW 3 64725015 missense probably benign 0.00
R6696:Vmn2r7 UTSW 3 64707074 missense probably benign 0.01
R6887:Vmn2r7 UTSW 3 64690827 missense probably damaging 1.00
R6918:Vmn2r7 UTSW 3 64691339 missense probably benign 0.03
R6949:Vmn2r7 UTSW 3 64691121 missense probably damaging 0.99
R6980:Vmn2r7 UTSW 3 64716566 missense possibly damaging 0.67
R7196:Vmn2r7 UTSW 3 64715777 missense probably benign 0.00
R7286:Vmn2r7 UTSW 3 64690880 missense probably benign 0.00
R7455:Vmn2r7 UTSW 3 64716593 missense probably benign
R7557:Vmn2r7 UTSW 3 64724973 missense probably benign
R7864:Vmn2r7 UTSW 3 64691526 missense probably benign 0.10
R8046:Vmn2r7 UTSW 3 64707058 missense probably damaging 1.00
R8068:Vmn2r7 UTSW 3 64716086 missense probably benign 0.01
R8252:Vmn2r7 UTSW 3 64693106 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGTTTCAGAGGTATGAACATGGG -3'
(R):5'- GTCTTGACCATTGAATTCTGGC -3'

Sequencing Primer
(F):5'- TGAACATGGGTGTAAACACTTG -3'
(R):5'- GGCAAACTGCTTTTAACTGTACCTGG -3'
Posted On2017-10-10