Incidental Mutation 'R0525:F11'
ID 48848
Institutional Source Beutler Lab
Gene Symbol F11
Ensembl Gene ENSMUSG00000031645
Gene Name coagulation factor XI
Synonyms plasma thromboplastin antecedent, 1600027G01Rik, Cf11, FXI
MMRRC Submission 038718-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.097) question?
Stock # R0525 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 45694211-45715068 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45706086 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 100 (F100L)
Ref Sequence ENSEMBL: ENSMUSP00000034064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034064]
AlphaFold Q91Y47
Predicted Effect probably benign
Transcript: ENSMUST00000034064
AA Change: F100L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000034064
Gene: ENSMUSG00000031645
AA Change: F100L

DomainStartEndE-ValueType
APPLE 20 103 2.89e-29 SMART
APPLE 110 193 1.02e-29 SMART
APPLE 200 283 2.29e-32 SMART
APPLE 291 376 1.04e-30 SMART
Tryp_SPc 389 617 1.54e-98 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210622
Meta Mutation Damage Score 0.3060 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: This gene encodes a glycoprotein coagulation factor that plays an important role in intrinsic pathway of blood coagulation and hemostasis. The encoded protein is an inactive zymogen that can be activated by coagulation factor XIIa, thrombin or factor XIa to generate active factor XIa protease. Mice lacking the encoded protein display a survival advantage during peritoneal sepsis and resist inflammation and bacterial accumulation upon infection with Listeria. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show a tendency for slightly prolonged tail transection bleeding times and are protected from vessel-occluding fibrin formation after transient ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933440M02Rik T A 7: 124,930,671 (GRCm39) noncoding transcript Het
A930002H24Rik A G 17: 64,170,642 (GRCm39) W49R unknown Het
Abca13 G A 11: 9,243,371 (GRCm39) V1745M probably damaging Het
Abca16 T G 7: 120,065,033 (GRCm39) Y563* probably null Het
Acot12 C T 13: 91,908,186 (GRCm39) probably benign Het
Alms1 G A 6: 85,564,742 (GRCm39) A39T unknown Het
Arid5b T C 10: 67,933,676 (GRCm39) D742G possibly damaging Het
Atp1a4 G A 1: 172,067,255 (GRCm39) probably benign Het
AU021092 T A 16: 5,035,725 (GRCm39) E145V possibly damaging Het
Calr4 A T 4: 109,099,461 (GRCm39) probably benign Het
Clip4 T A 17: 72,106,093 (GRCm39) probably null Het
Cnpy4 A T 5: 138,190,878 (GRCm39) H180L probably benign Het
Cyp2j9 T C 4: 96,467,802 (GRCm39) probably null Het
Dgkq A G 5: 108,802,481 (GRCm39) S406P probably damaging Het
Dhx8 G A 11: 101,654,754 (GRCm39) C1014Y probably damaging Het
Dnah3 T C 7: 119,527,977 (GRCm39) Y3824C probably damaging Het
Donson A T 16: 91,483,133 (GRCm39) H69Q probably damaging Het
Dppa3 A G 6: 122,606,939 (GRCm39) E143G probably damaging Het
Drg1 A G 11: 3,212,545 (GRCm39) F96L probably damaging Het
Dvl1 A C 4: 155,940,052 (GRCm39) T395P probably damaging Het
Eftud2 A T 11: 102,730,079 (GRCm39) V897D probably damaging Het
Enpp6 A G 8: 47,535,478 (GRCm39) N341S possibly damaging Het
Fas T C 19: 34,296,727 (GRCm39) Y189H probably damaging Het
Galnt14 G T 17: 73,852,076 (GRCm39) S114R probably damaging Het
Gfpt2 A G 11: 49,720,602 (GRCm39) I528V probably benign Het
Glt6d1 A G 2: 25,684,280 (GRCm39) V242A possibly damaging Het
Grm1 A T 10: 10,594,953 (GRCm39) probably benign Het
Gskip G A 12: 105,665,224 (GRCm39) A88T probably damaging Het
Gtpbp1 A G 15: 79,597,648 (GRCm39) I348V probably benign Het
Hnrnpul1 C A 7: 25,440,308 (GRCm39) R316L possibly damaging Het
Il34 T C 8: 111,474,915 (GRCm39) E121G probably damaging Het
Lrr1 T C 12: 69,215,685 (GRCm39) L19P probably damaging Het
Mat2b A G 11: 40,573,496 (GRCm39) probably benign Het
Mettl21e T C 1: 44,245,542 (GRCm39) K235E probably damaging Het
Mir124-2hg T A 3: 17,839,693 (GRCm39) E126V possibly damaging Het
Myh15 A G 16: 48,952,414 (GRCm39) K828R probably benign Het
Myom3 A G 4: 135,492,237 (GRCm39) D127G possibly damaging Het
Nek5 C A 8: 22,569,093 (GRCm39) probably benign Het
Nudt7 A T 8: 114,878,392 (GRCm39) probably null Het
Or10ag56 A T 2: 87,139,693 (GRCm39) T187S probably benign Het
Or10d4c T G 9: 39,558,767 (GRCm39) C248W probably damaging Het
Or1j4 T C 2: 36,740,202 (GRCm39) L48P probably damaging Het
Or4a67 G A 2: 88,597,658 (GRCm39) Q334* probably null Het
Or8k23 C T 2: 86,186,619 (GRCm39) V36I probably benign Het
Phyhd1 A G 2: 30,171,040 (GRCm39) H241R probably damaging Het
Pmch T C 10: 87,927,262 (GRCm39) probably benign Het
Ror1 A G 4: 100,298,717 (GRCm39) S697G probably damaging Het
Rslcan18 A G 13: 67,260,322 (GRCm39) V25A probably benign Het
Sema6b T C 17: 56,433,630 (GRCm39) H426R probably damaging Het
Serpina3g T C 12: 104,204,598 (GRCm39) F9S probably damaging Het
Serpinb12 T A 1: 106,874,432 (GRCm39) H52Q probably benign Het
Sh3gl1 T C 17: 56,324,873 (GRCm39) K294R probably benign Het
Sidt1 G T 16: 44,079,809 (GRCm39) T615K possibly damaging Het
Slc16a4 A C 3: 107,205,255 (GRCm39) probably benign Het
Sned1 T A 1: 93,199,696 (GRCm39) probably null Het
Sp2 A T 11: 96,846,924 (GRCm39) probably benign Het
Steap1 T A 5: 5,792,903 (GRCm39) I3F possibly damaging Het
Stxbp5l A T 16: 36,950,159 (GRCm39) probably null Het
Tbc1d9 G T 8: 83,995,614 (GRCm39) V968F probably benign Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Triobp T C 15: 78,858,098 (GRCm39) L1233P possibly damaging Het
Trp53bp1 C A 2: 121,082,349 (GRCm39) A317S probably null Het
Trpc4ap A G 2: 155,482,398 (GRCm39) F531L possibly damaging Het
Ugt1a10 C T 1: 88,145,971 (GRCm39) P473L probably damaging Het
Vmn1r86 T C 7: 12,836,088 (GRCm39) K213E probably benign Het
Vps8 G A 16: 21,358,859 (GRCm39) probably null Het
Wnk1 A T 6: 119,903,525 (GRCm39) S2563T probably damaging Het
Yrdc C G 4: 124,745,559 (GRCm39) R3G probably damaging Het
Zfp287 A T 11: 62,606,070 (GRCm39) V279E probably benign Het
Other mutations in F11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:F11 APN 8 45,703,132 (GRCm39) missense probably damaging 1.00
IGL02096:F11 APN 8 45,699,791 (GRCm39) missense probably benign 0.05
IGL02363:F11 APN 8 45,694,568 (GRCm39) missense probably damaging 1.00
IGL02694:F11 APN 8 45,705,196 (GRCm39) missense probably damaging 1.00
IGL03374:F11 APN 8 45,714,111 (GRCm39) missense possibly damaging 0.63
R0225:F11 UTSW 8 45,702,114 (GRCm39) missense probably benign 0.00
R0842:F11 UTSW 8 45,705,196 (GRCm39) missense probably damaging 1.00
R0961:F11 UTSW 8 45,694,531 (GRCm39) missense probably damaging 1.00
R1605:F11 UTSW 8 45,694,617 (GRCm39) missense probably damaging 1.00
R2044:F11 UTSW 8 45,705,155 (GRCm39) missense probably benign 0.03
R2113:F11 UTSW 8 45,699,869 (GRCm39) missense probably benign 0.00
R2273:F11 UTSW 8 45,705,184 (GRCm39) missense possibly damaging 0.94
R2274:F11 UTSW 8 45,705,184 (GRCm39) missense possibly damaging 0.94
R2275:F11 UTSW 8 45,705,184 (GRCm39) missense possibly damaging 0.94
R2318:F11 UTSW 8 45,701,675 (GRCm39) missense probably damaging 1.00
R2319:F11 UTSW 8 45,701,675 (GRCm39) missense probably damaging 1.00
R2403:F11 UTSW 8 45,701,675 (GRCm39) missense probably damaging 1.00
R2510:F11 UTSW 8 45,701,675 (GRCm39) missense probably damaging 1.00
R2512:F11 UTSW 8 45,714,098 (GRCm39) missense probably benign 0.01
R2893:F11 UTSW 8 45,701,675 (GRCm39) missense probably damaging 1.00
R2894:F11 UTSW 8 45,701,675 (GRCm39) missense probably damaging 1.00
R2910:F11 UTSW 8 45,694,486 (GRCm39) makesense probably null
R3030:F11 UTSW 8 45,701,675 (GRCm39) missense probably damaging 1.00
R3105:F11 UTSW 8 45,698,754 (GRCm39) missense probably damaging 0.97
R3721:F11 UTSW 8 45,701,675 (GRCm39) missense probably damaging 1.00
R3726:F11 UTSW 8 45,701,675 (GRCm39) missense probably damaging 1.00
R3906:F11 UTSW 8 45,701,675 (GRCm39) missense probably damaging 1.00
R3909:F11 UTSW 8 45,701,675 (GRCm39) missense probably damaging 1.00
R4465:F11 UTSW 8 45,694,511 (GRCm39) missense probably damaging 1.00
R4467:F11 UTSW 8 45,694,511 (GRCm39) missense probably damaging 1.00
R4710:F11 UTSW 8 45,703,183 (GRCm39) missense probably damaging 1.00
R4824:F11 UTSW 8 45,708,379 (GRCm39) missense probably damaging 0.99
R4968:F11 UTSW 8 45,698,770 (GRCm39) missense probably benign 0.19
R5225:F11 UTSW 8 45,708,341 (GRCm39) missense probably benign 0.09
R5288:F11 UTSW 8 45,699,833 (GRCm39) missense probably damaging 1.00
R5378:F11 UTSW 8 45,705,180 (GRCm39) missense probably benign 0.19
R6155:F11 UTSW 8 45,705,119 (GRCm39) missense probably damaging 1.00
R6213:F11 UTSW 8 45,694,537 (GRCm39) missense probably damaging 1.00
R6615:F11 UTSW 8 45,701,811 (GRCm39) missense probably benign
R6797:F11 UTSW 8 45,706,092 (GRCm39) missense probably benign 0.02
R7147:F11 UTSW 8 45,703,183 (GRCm39) missense probably damaging 1.00
R7683:F11 UTSW 8 45,702,545 (GRCm39) missense probably damaging 0.97
R7688:F11 UTSW 8 45,703,127 (GRCm39) missense probably damaging 1.00
R7720:F11 UTSW 8 45,705,127 (GRCm39) missense possibly damaging 0.89
R8064:F11 UTSW 8 45,698,810 (GRCm39) missense probably benign 0.01
R8273:F11 UTSW 8 45,701,644 (GRCm39) missense possibly damaging 0.70
R8848:F11 UTSW 8 45,695,281 (GRCm39) nonsense probably null
R8901:F11 UTSW 8 45,701,851 (GRCm39) missense probably benign 0.01
R9141:F11 UTSW 8 45,703,092 (GRCm39) critical splice donor site probably null
R9188:F11 UTSW 8 45,698,736 (GRCm39) missense probably benign 0.00
R9658:F11 UTSW 8 45,698,671 (GRCm39) missense probably damaging 1.00
R9664:F11 UTSW 8 45,694,566 (GRCm39) nonsense probably null
U24488:F11 UTSW 8 45,695,349 (GRCm39) missense probably benign 0.04
Z1088:F11 UTSW 8 45,698,809 (GRCm39) missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ACTTACTGAAAAGTGCCCGTTCCAC -3'
(R):5'- CAGGAAACCCAGTCGTTTGTCTCC -3'

Sequencing Primer
(F):5'- GGGAGAAAACTGTGTCCTCTACTC -3'
(R):5'- GTTTGTCTCCTTCTCTTTGACCTTAG -3'
Posted On 2013-06-12