Incidental Mutation 'R6139:Arhgap35'
ID488487
Institutional Source Beutler Lab
Gene Symbol Arhgap35
Ensembl Gene ENSMUSG00000058230
Gene NameRho GTPase activating protein 35
Synonymsp190RhoGAP, p190A, Grlf1, P190 RhoGAP, 6430596G11Rik
MMRRC Submission 044286-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6139 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location16493719-16614993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16563467 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 558 (T558A)
Ref Sequence ENSEMBL: ENSMUSP00000127379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075845] [ENSMUST00000171937]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075845
AA Change: T558A

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075242
Gene: ENSMUSG00000058230
AA Change: T558A

DomainStartEndE-ValueType
Pfam:Ras 154 249 6.1e-7 PFAM
FF 270 327 5.76e-9 SMART
FF 369 422 1.1e-5 SMART
FF 429 483 7.43e-12 SMART
FF 485 539 2.02e-4 SMART
Blast:RhoGAP 733 796 1e-7 BLAST
low complexity region 1037 1048 N/A INTRINSIC
low complexity region 1214 1225 N/A INTRINSIC
low complexity region 1227 1235 N/A INTRINSIC
RhoGAP 1259 1433 8.14e-72 SMART
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1462 1494 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171937
AA Change: T558A

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127379
Gene: ENSMUSG00000058230
AA Change: T558A

DomainStartEndE-ValueType
Pfam:Ras 154 249 6e-7 PFAM
FF 270 327 5.76e-9 SMART
FF 369 422 1.1e-5 SMART
FF 429 483 7.43e-12 SMART
FF 485 539 2.02e-4 SMART
Blast:RhoGAP 733 796 1e-7 BLAST
low complexity region 1037 1048 N/A INTRINSIC
low complexity region 1214 1225 N/A INTRINSIC
low complexity region 1227 1235 N/A INTRINSIC
RhoGAP 1259 1433 8.14e-72 SMART
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1462 1494 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The human glucocorticoid receptor DNA binding factor, which associates with the promoter region of the glucocorticoid receptor gene (hGR gene), is a repressor of glucocorticoid receptor transcription. The amino acid sequence deduced from the cDNA sequences show the presence of three sequence motifs characteristic of a zinc finger and one motif suggestive of a leucine zipper in which 1 cysteine is found instead of all leucines. The GRLF1 enhances the homologous down-regulation of wild-type hGR gene expression. Biochemical analysis suggests that GRLF1 interaction is sequence specific and that transcriptional efficacy of GRLF1 is regulated through its interaction with specific sequence motif. The level of expression is regulated by glucocorticoids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die within 2 days of birth and never survive beyond 3 weeks. Observed phenotypes include defects in eye morphogenesis, forebrain development, neural tube closure, axon guidance and fasciculation, and renal abnormalities, including hypoplastic and glomerulocystic kidneys, associated with a ciliogenesis defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A G 11: 117,806,324 T250A probably damaging Het
Acacb T C 5: 114,212,652 I1074T probably damaging Het
Acsl6 C A 11: 54,340,542 P462T probably damaging Het
Aebp1 A G 11: 5,871,842 D747G probably damaging Het
Antxr2 A C 5: 97,977,706 probably null Het
Asap1 T A 15: 64,166,539 I223F possibly damaging Het
C2cd5 A C 6: 143,035,058 D669E probably damaging Het
Casz1 C T 4: 148,951,697 T1472M probably damaging Het
Catsper4 A G 4: 134,217,866 L154P probably damaging Het
Cep350 T C 1: 155,953,279 E293G probably benign Het
Cma1 T A 14: 55,942,700 probably null Het
Ddx42 C T 11: 106,240,017 A439V probably damaging Het
Disp2 T A 2: 118,790,662 L625Q probably damaging Het
Dnah1 T C 14: 31,286,027 D2141G probably benign Het
Dsp T C 13: 38,192,406 I1389T probably damaging Het
Fam81a A T 9: 70,102,818 probably null Het
Fsip2 A G 2: 82,991,044 D5707G possibly damaging Het
Gcnt4 G A 13: 96,946,852 V219I probably benign Het
Gk2 A G 5: 97,456,280 V233A probably benign Het
Grm1 T C 10: 10,746,331 probably benign Het
Gsap T A 5: 21,281,540 V649D probably damaging Het
Kif1b G A 4: 149,237,532 H977Y possibly damaging Het
Ktn1 T A 14: 47,726,215 probably null Het
Lgals12 T A 19: 7,604,377 T29S probably benign Het
Me3 G T 7: 89,632,900 probably benign Het
Mgst3 T G 1: 167,378,305 K35T possibly damaging Het
Mtmr9 T C 14: 63,529,778 R354G probably benign Het
Myh11 T C 16: 14,215,874 E1059G probably damaging Het
Nr4a2 T A 2: 57,108,689 H408L probably damaging Het
Olfr689 A T 7: 105,314,246 T81S probably damaging Het
Olfr993 A T 2: 85,414,346 F178I probably damaging Het
Pds5b T A 5: 150,800,777 L1275Q possibly damaging Het
Pfkfb4 A G 9: 109,027,757 Y412C probably damaging Het
Pop1 T A 15: 34,529,058 C745S probably benign Het
Ptpn14 T G 1: 189,851,165 S736R probably benign Het
Rdh9 A T 10: 127,776,737 T85S possibly damaging Het
Rnf223 T C 4: 156,132,803 C212R probably damaging Het
Rnf39 A G 17: 36,943,338 E84G probably damaging Het
Sfmbt1 T A 14: 30,811,418 V584D probably damaging Het
Slc12a5 T A 2: 164,992,311 S728T probably damaging Het
Slc16a12 T A 19: 34,670,895 probably null Het
Snupn C A 9: 56,982,824 Q310K possibly damaging Het
St7 T C 6: 17,694,354 L48P probably damaging Het
Thsd7a T C 6: 12,379,573 N951D possibly damaging Het
Ttn G A 2: 76,852,069 R959* probably null Het
Ugt2b36 A T 5: 87,092,171 D118E probably benign Het
Vmn2r7 G A 3: 64,715,918 T327I probably damaging Het
Wdr70 T C 15: 8,079,251 D137G probably benign Het
Wrn A T 8: 33,353,332 M14K probably damaging Het
Xpot T A 10: 121,611,708 E283V probably benign Het
Other mutations in Arhgap35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Arhgap35 APN 7 16564415 missense probably benign 0.03
IGL00684:Arhgap35 APN 7 16561700 missense possibly damaging 0.93
IGL01385:Arhgap35 APN 7 16564474 missense probably damaging 0.96
IGL01411:Arhgap35 APN 7 16564267 missense probably benign
IGL01922:Arhgap35 APN 7 16564255 missense possibly damaging 0.73
IGL01977:Arhgap35 APN 7 16563203 missense probably damaging 1.00
IGL02074:Arhgap35 APN 7 16563055 missense probably benign 0.19
IGL02305:Arhgap35 APN 7 16563665 missense probably benign 0.15
IGL02342:Arhgap35 APN 7 16562380 missense probably benign 0.12
IGL02973:Arhgap35 APN 7 16562878 missense possibly damaging 0.50
IGL02989:Arhgap35 APN 7 16497655 makesense probably null
PIT4382001:Arhgap35 UTSW 7 16563869 missense possibly damaging 0.95
PIT4431001:Arhgap35 UTSW 7 16561611 missense possibly damaging 0.87
R0047:Arhgap35 UTSW 7 16561992 missense probably benign 0.17
R1690:Arhgap35 UTSW 7 16563281 missense probably damaging 1.00
R1820:Arhgap35 UTSW 7 16561949 missense possibly damaging 0.92
R2036:Arhgap35 UTSW 7 16563133 missense probably damaging 1.00
R2205:Arhgap35 UTSW 7 16498025 splice site probably null
R2292:Arhgap35 UTSW 7 16563551 missense probably damaging 1.00
R3079:Arhgap35 UTSW 7 16562576 missense probably damaging 1.00
R3745:Arhgap35 UTSW 7 16563722 missense probably damaging 1.00
R3762:Arhgap35 UTSW 7 16565075 missense probably damaging 0.98
R4661:Arhgap35 UTSW 7 16564738 missense probably damaging 1.00
R4709:Arhgap35 UTSW 7 16563586 missense probably damaging 0.97
R4749:Arhgap35 UTSW 7 16498626 missense possibly damaging 0.95
R5081:Arhgap35 UTSW 7 16565134 missense possibly damaging 0.71
R5131:Arhgap35 UTSW 7 16511187 splice site probably null
R5175:Arhgap35 UTSW 7 16562599 missense probably damaging 1.00
R5440:Arhgap35 UTSW 7 16562924 missense probably damaging 1.00
R5517:Arhgap35 UTSW 7 16563489 missense probably damaging 1.00
R5987:Arhgap35 UTSW 7 16563467 missense possibly damaging 0.84
R6087:Arhgap35 UTSW 7 16563643 missense probably damaging 1.00
R6396:Arhgap35 UTSW 7 16562299 missense probably damaging 0.99
R6878:Arhgap35 UTSW 7 16565113 missense probably benign 0.00
R7063:Arhgap35 UTSW 7 16565113 missense probably benign 0.00
R7150:Arhgap35 UTSW 7 16562566 missense probably damaging 0.96
R7269:Arhgap35 UTSW 7 16561727 missense probably benign
R7276:Arhgap35 UTSW 7 16564568 missense probably damaging 1.00
R7517:Arhgap35 UTSW 7 16562207 missense probably benign 0.31
R7593:Arhgap35 UTSW 7 16564861 missense probably damaging 1.00
R7775:Arhgap35 UTSW 7 16562648 missense probably benign 0.01
R7792:Arhgap35 UTSW 7 16561528 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTTCATTGGCCAACTCTCGGG -3'
(R):5'- GGACATCTATGGCAAGCACC -3'

Sequencing Primer
(F):5'- GCAAGGCCATCTTTGCCTAAG -3'
(R):5'- CCAAGAGTTGCTTTTGGAGTACTCAG -3'
Posted On2017-10-10