Incidental Mutation 'R6139:Arhgap35'
ID 488487
Institutional Source Beutler Lab
Gene Symbol Arhgap35
Ensembl Gene ENSMUSG00000058230
Gene Name Rho GTPase activating protein 35
Synonyms p190RhoGAP, p190A, Grlf1, P190 RhoGAP, 6430596G11Rik
MMRRC Submission 044286-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6139 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 16493719-16614993 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 16563467 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 558 (T558A)
Ref Sequence ENSEMBL: ENSMUSP00000127379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075845] [ENSMUST00000171937]
AlphaFold Q91YM2
Predicted Effect possibly damaging
Transcript: ENSMUST00000075845
AA Change: T558A

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075242
Gene: ENSMUSG00000058230
AA Change: T558A

DomainStartEndE-ValueType
Pfam:Ras 154 249 6.1e-7 PFAM
FF 270 327 5.76e-9 SMART
FF 369 422 1.1e-5 SMART
FF 429 483 7.43e-12 SMART
FF 485 539 2.02e-4 SMART
Blast:RhoGAP 733 796 1e-7 BLAST
low complexity region 1037 1048 N/A INTRINSIC
low complexity region 1214 1225 N/A INTRINSIC
low complexity region 1227 1235 N/A INTRINSIC
RhoGAP 1259 1433 8.14e-72 SMART
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1462 1494 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171937
AA Change: T558A

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127379
Gene: ENSMUSG00000058230
AA Change: T558A

DomainStartEndE-ValueType
Pfam:Ras 154 249 6e-7 PFAM
FF 270 327 5.76e-9 SMART
FF 369 422 1.1e-5 SMART
FF 429 483 7.43e-12 SMART
FF 485 539 2.02e-4 SMART
Blast:RhoGAP 733 796 1e-7 BLAST
low complexity region 1037 1048 N/A INTRINSIC
low complexity region 1214 1225 N/A INTRINSIC
low complexity region 1227 1235 N/A INTRINSIC
RhoGAP 1259 1433 8.14e-72 SMART
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1462 1494 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The human glucocorticoid receptor DNA binding factor, which associates with the promoter region of the glucocorticoid receptor gene (hGR gene), is a repressor of glucocorticoid receptor transcription. The amino acid sequence deduced from the cDNA sequences show the presence of three sequence motifs characteristic of a zinc finger and one motif suggestive of a leucine zipper in which 1 cysteine is found instead of all leucines. The GRLF1 enhances the homologous down-regulation of wild-type hGR gene expression. Biochemical analysis suggests that GRLF1 interaction is sequence specific and that transcriptional efficacy of GRLF1 is regulated through its interaction with specific sequence motif. The level of expression is regulated by glucocorticoids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die within 2 days of birth and never survive beyond 3 weeks. Observed phenotypes include defects in eye morphogenesis, forebrain development, neural tube closure, axon guidance and fasciculation, and renal abnormalities, including hypoplastic and glomerulocystic kidneys, associated with a ciliogenesis defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A G 11: 117,806,324 (GRCm38) T250A probably damaging Het
Acacb T C 5: 114,212,652 (GRCm38) I1074T probably damaging Het
Acsl6 C A 11: 54,340,542 (GRCm38) P462T probably damaging Het
Aebp1 A G 11: 5,871,842 (GRCm38) D747G probably damaging Het
Antxr2 A C 5: 97,977,706 (GRCm38) probably null Het
Asap1 T A 15: 64,166,539 (GRCm38) I223F possibly damaging Het
C2cd5 A C 6: 143,035,058 (GRCm38) D669E probably damaging Het
Casz1 C T 4: 148,951,697 (GRCm38) T1472M probably damaging Het
Catsper4 A G 4: 134,217,866 (GRCm38) L154P probably damaging Het
Cep350 T C 1: 155,953,279 (GRCm38) E293G probably benign Het
Cma1 T A 14: 55,942,700 (GRCm38) probably null Het
Ddx42 C T 11: 106,240,017 (GRCm38) A439V probably damaging Het
Disp2 T A 2: 118,790,662 (GRCm38) L625Q probably damaging Het
Dnah1 T C 14: 31,286,027 (GRCm38) D2141G probably benign Het
Dsp T C 13: 38,192,406 (GRCm38) I1389T probably damaging Het
Fam81a A T 9: 70,102,818 (GRCm38) probably null Het
Fsip2 A G 2: 82,991,044 (GRCm38) D5707G possibly damaging Het
Gcnt4 G A 13: 96,946,852 (GRCm38) V219I probably benign Het
Gk2 A G 5: 97,456,280 (GRCm38) V233A probably benign Het
Grm1 T C 10: 10,746,331 (GRCm38) probably benign Het
Gsap T A 5: 21,281,540 (GRCm38) V649D probably damaging Het
Kif1b G A 4: 149,237,532 (GRCm38) H977Y possibly damaging Het
Ktn1 T A 14: 47,726,215 (GRCm38) probably null Het
Lgals12 T A 19: 7,604,377 (GRCm38) T29S probably benign Het
Me3 G T 7: 89,632,900 (GRCm38) probably benign Het
Mgst3 T G 1: 167,378,305 (GRCm38) K35T possibly damaging Het
Mtmr9 T C 14: 63,529,778 (GRCm38) R354G probably benign Het
Myh11 T C 16: 14,215,874 (GRCm38) E1059G probably damaging Het
Nr4a2 T A 2: 57,108,689 (GRCm38) H408L probably damaging Het
Or56b35 A T 7: 105,314,246 (GRCm38) T81S probably damaging Het
Or5ak23 A T 2: 85,414,346 (GRCm38) F178I probably damaging Het
Pds5b T A 5: 150,800,777 (GRCm38) L1275Q possibly damaging Het
Pfkfb4 A G 9: 109,027,757 (GRCm38) Y412C probably damaging Het
Pop1 T A 15: 34,529,058 (GRCm38) C745S probably benign Het
Ptpn14 T G 1: 189,851,165 (GRCm38) S736R probably benign Het
Rdh9 A T 10: 127,776,737 (GRCm38) T85S possibly damaging Het
Rnf223 T C 4: 156,132,803 (GRCm38) C212R probably damaging Het
Rnf39 A G 17: 36,943,338 (GRCm38) E84G probably damaging Het
Sfmbt1 T A 14: 30,811,418 (GRCm38) V584D probably damaging Het
Slc12a5 T A 2: 164,992,311 (GRCm38) S728T probably damaging Het
Slc16a12 T A 19: 34,670,895 (GRCm38) probably null Het
Snupn C A 9: 56,982,824 (GRCm38) Q310K possibly damaging Het
St7 T C 6: 17,694,354 (GRCm38) L48P probably damaging Het
Thsd7a T C 6: 12,379,573 (GRCm38) N951D possibly damaging Het
Ttn G A 2: 76,852,069 (GRCm38) R959* probably null Het
Ugt2b36 A T 5: 87,092,171 (GRCm38) D118E probably benign Het
Vmn2r7 G A 3: 64,715,918 (GRCm38) T327I probably damaging Het
Wdr70 T C 15: 8,079,251 (GRCm38) D137G probably benign Het
Wrn A T 8: 33,353,332 (GRCm38) M14K probably damaging Het
Xpot T A 10: 121,611,708 (GRCm38) E283V probably benign Het
Other mutations in Arhgap35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Arhgap35 APN 7 16,564,415 (GRCm38) missense probably benign 0.03
IGL00684:Arhgap35 APN 7 16,561,700 (GRCm38) missense possibly damaging 0.93
IGL01385:Arhgap35 APN 7 16,564,474 (GRCm38) missense probably damaging 0.96
IGL01411:Arhgap35 APN 7 16,564,267 (GRCm38) missense probably benign
IGL01922:Arhgap35 APN 7 16,564,255 (GRCm38) missense possibly damaging 0.73
IGL01977:Arhgap35 APN 7 16,563,203 (GRCm38) missense probably damaging 1.00
IGL02074:Arhgap35 APN 7 16,563,055 (GRCm38) missense probably benign 0.19
IGL02305:Arhgap35 APN 7 16,563,665 (GRCm38) missense probably benign 0.15
IGL02342:Arhgap35 APN 7 16,562,380 (GRCm38) missense probably benign 0.12
IGL02973:Arhgap35 APN 7 16,562,878 (GRCm38) missense possibly damaging 0.50
IGL02989:Arhgap35 APN 7 16,497,655 (GRCm38) makesense probably null
PIT4382001:Arhgap35 UTSW 7 16,563,869 (GRCm38) missense possibly damaging 0.95
PIT4431001:Arhgap35 UTSW 7 16,561,611 (GRCm38) missense possibly damaging 0.87
R0047:Arhgap35 UTSW 7 16,561,992 (GRCm38) missense probably benign 0.17
R1690:Arhgap35 UTSW 7 16,563,281 (GRCm38) missense probably damaging 1.00
R1820:Arhgap35 UTSW 7 16,561,949 (GRCm38) missense possibly damaging 0.92
R2036:Arhgap35 UTSW 7 16,563,133 (GRCm38) missense probably damaging 1.00
R2205:Arhgap35 UTSW 7 16,498,025 (GRCm38) splice site probably null
R2292:Arhgap35 UTSW 7 16,563,551 (GRCm38) missense probably damaging 1.00
R3079:Arhgap35 UTSW 7 16,562,576 (GRCm38) missense probably damaging 1.00
R3745:Arhgap35 UTSW 7 16,563,722 (GRCm38) missense probably damaging 1.00
R3762:Arhgap35 UTSW 7 16,565,075 (GRCm38) missense probably damaging 0.98
R4661:Arhgap35 UTSW 7 16,564,738 (GRCm38) missense probably damaging 1.00
R4709:Arhgap35 UTSW 7 16,563,586 (GRCm38) missense probably damaging 0.97
R4749:Arhgap35 UTSW 7 16,498,626 (GRCm38) missense possibly damaging 0.95
R5081:Arhgap35 UTSW 7 16,565,134 (GRCm38) missense possibly damaging 0.71
R5131:Arhgap35 UTSW 7 16,511,187 (GRCm38) splice site probably null
R5175:Arhgap35 UTSW 7 16,562,599 (GRCm38) missense probably damaging 1.00
R5440:Arhgap35 UTSW 7 16,562,924 (GRCm38) missense probably damaging 1.00
R5517:Arhgap35 UTSW 7 16,563,489 (GRCm38) missense probably damaging 1.00
R5987:Arhgap35 UTSW 7 16,563,467 (GRCm38) missense possibly damaging 0.84
R6087:Arhgap35 UTSW 7 16,563,643 (GRCm38) missense probably damaging 1.00
R6396:Arhgap35 UTSW 7 16,562,299 (GRCm38) missense probably damaging 0.99
R6878:Arhgap35 UTSW 7 16,565,113 (GRCm38) missense probably benign 0.00
R7063:Arhgap35 UTSW 7 16,565,113 (GRCm38) missense probably benign 0.00
R7150:Arhgap35 UTSW 7 16,562,566 (GRCm38) missense probably damaging 0.96
R7269:Arhgap35 UTSW 7 16,561,727 (GRCm38) missense probably benign
R7276:Arhgap35 UTSW 7 16,564,568 (GRCm38) missense probably damaging 1.00
R7517:Arhgap35 UTSW 7 16,562,207 (GRCm38) missense probably benign 0.31
R7593:Arhgap35 UTSW 7 16,564,861 (GRCm38) missense probably damaging 1.00
R7775:Arhgap35 UTSW 7 16,562,648 (GRCm38) missense probably benign 0.01
R7792:Arhgap35 UTSW 7 16,561,528 (GRCm38) missense possibly damaging 0.88
R8101:Arhgap35 UTSW 7 16,562,319 (GRCm38) missense probably benign 0.00
R8873:Arhgap35 UTSW 7 16,561,490 (GRCm38) missense possibly damaging 0.92
R8956:Arhgap35 UTSW 7 16,614,479 (GRCm38) start gained probably benign
R9163:Arhgap35 UTSW 7 16,561,624 (GRCm38) missense possibly damaging 0.94
R9507:Arhgap35 UTSW 7 16,563,418 (GRCm38) missense probably benign 0.31
R9667:Arhgap35 UTSW 7 16,562,989 (GRCm38) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTCATTGGCCAACTCTCGGG -3'
(R):5'- GGACATCTATGGCAAGCACC -3'

Sequencing Primer
(F):5'- GCAAGGCCATCTTTGCCTAAG -3'
(R):5'- CCAAGAGTTGCTTTTGGAGTACTCAG -3'
Posted On 2017-10-10