Incidental Mutation 'R6139:Rdh9'
ID 488496
Institutional Source Beutler Lab
Gene Symbol Rdh9
Ensembl Gene ENSMUSG00000056148
Gene Name retinol dehydrogenase 9
Synonyms Crad3
MMRRC Submission 044286-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6139 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 127776386-127792697 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 127776737 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 85 (T85S)
Ref Sequence ENSEMBL: ENSMUSP00000057732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052652] [ENSMUST00000128247] [ENSMUST00000136223]
AlphaFold Q8K5C8
Predicted Effect possibly damaging
Transcript: ENSMUST00000052652
AA Change: T85S

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000057732
Gene: ENSMUSG00000056148
AA Change: T85S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:adh_short 30 220 3.1e-41 PFAM
Pfam:DUF1776 43 303 5.7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128133
Predicted Effect probably benign
Transcript: ENSMUST00000128247
SMART Domains Protein: ENSMUSP00000116574
Gene: ENSMUSG00000099009

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:adh_short 30 195 1.7e-23 PFAM
Pfam:DUF1776 43 303 3.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136223
AA Change: T85S

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000120523
Gene: ENSMUSG00000056148
AA Change: T85S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:adh_short 30 116 9.4e-9 PFAM
Meta Mutation Damage Score 0.2182 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and healthy, with no apparent alterations in tissue retinoid and serum dihydrotestosterone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A G 11: 117,806,324 T250A probably damaging Het
Acacb T C 5: 114,212,652 I1074T probably damaging Het
Acsl6 C A 11: 54,340,542 P462T probably damaging Het
Aebp1 A G 11: 5,871,842 D747G probably damaging Het
Antxr2 A C 5: 97,977,706 probably null Het
Arhgap35 T C 7: 16,563,467 T558A possibly damaging Het
Asap1 T A 15: 64,166,539 I223F possibly damaging Het
C2cd5 A C 6: 143,035,058 D669E probably damaging Het
Casz1 C T 4: 148,951,697 T1472M probably damaging Het
Catsper4 A G 4: 134,217,866 L154P probably damaging Het
Cep350 T C 1: 155,953,279 E293G probably benign Het
Cma1 T A 14: 55,942,700 probably null Het
Ddx42 C T 11: 106,240,017 A439V probably damaging Het
Disp2 T A 2: 118,790,662 L625Q probably damaging Het
Dnah1 T C 14: 31,286,027 D2141G probably benign Het
Dsp T C 13: 38,192,406 I1389T probably damaging Het
Fam81a A T 9: 70,102,818 probably null Het
Fsip2 A G 2: 82,991,044 D5707G possibly damaging Het
Gcnt4 G A 13: 96,946,852 V219I probably benign Het
Gk2 A G 5: 97,456,280 V233A probably benign Het
Grm1 T C 10: 10,746,331 probably benign Het
Gsap T A 5: 21,281,540 V649D probably damaging Het
Kif1b G A 4: 149,237,532 H977Y possibly damaging Het
Ktn1 T A 14: 47,726,215 probably null Het
Lgals12 T A 19: 7,604,377 T29S probably benign Het
Me3 G T 7: 89,632,900 probably benign Het
Mgst3 T G 1: 167,378,305 K35T possibly damaging Het
Mtmr9 T C 14: 63,529,778 R354G probably benign Het
Myh11 T C 16: 14,215,874 E1059G probably damaging Het
Nr4a2 T A 2: 57,108,689 H408L probably damaging Het
Olfr689 A T 7: 105,314,246 T81S probably damaging Het
Olfr993 A T 2: 85,414,346 F178I probably damaging Het
Pds5b T A 5: 150,800,777 L1275Q possibly damaging Het
Pfkfb4 A G 9: 109,027,757 Y412C probably damaging Het
Pop1 T A 15: 34,529,058 C745S probably benign Het
Ptpn14 T G 1: 189,851,165 S736R probably benign Het
Rnf223 T C 4: 156,132,803 C212R probably damaging Het
Rnf39 A G 17: 36,943,338 E84G probably damaging Het
Sfmbt1 T A 14: 30,811,418 V584D probably damaging Het
Slc12a5 T A 2: 164,992,311 S728T probably damaging Het
Slc16a12 T A 19: 34,670,895 probably null Het
Snupn C A 9: 56,982,824 Q310K possibly damaging Het
St7 T C 6: 17,694,354 L48P probably damaging Het
Thsd7a T C 6: 12,379,573 N951D possibly damaging Het
Ttn G A 2: 76,852,069 R959* probably null Het
Ugt2b36 A T 5: 87,092,171 D118E probably benign Het
Vmn2r7 G A 3: 64,715,918 T327I probably damaging Het
Wdr70 T C 15: 8,079,251 D137G probably benign Het
Wrn A T 8: 33,353,332 M14K probably damaging Het
Xpot T A 10: 121,611,708 E283V probably benign Het
Other mutations in Rdh9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Rdh9 APN 10 127790984 missense probably benign 0.00
IGL01348:Rdh9 APN 10 127776792 missense probably benign 0.07
IGL01474:Rdh9 APN 10 127790945 missense probably damaging 1.00
R0659:Rdh9 UTSW 10 127776575 missense possibly damaging 0.52
R4729:Rdh9 UTSW 10 127776752 missense probably benign 0.02
R6279:Rdh9 UTSW 10 127776758 missense probably benign
R7870:Rdh9 UTSW 10 127776697 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGTGAGCTATCTCCAAGACAAG -3'
(R):5'- ACACACAGCTTGGAGGACTC -3'

Sequencing Primer
(F):5'- ACAAGTATGTCTTCATCACGGGC -3'
(R):5'- CACAGCTTGGAGGACTCAGTGTAG -3'
Posted On 2017-10-10