Incidental Mutation 'R6139:Cma1'
ID488505
Institutional Source Beutler Lab
Gene Symbol Cma1
Ensembl Gene ENSMUSG00000022225
Gene Namechymase 1, mast cell
SynonymsMcp-5, MMCP-5, Mcpt5, Mcp5
MMRRC Submission 044286-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R6139 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location55941451-55944675 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 55942700 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022834] [ENSMUST00000022834] [ENSMUST00000226280] [ENSMUST00000226280]
Predicted Effect probably null
Transcript: ENSMUST00000022834
SMART Domains Protein: ENSMUSP00000022834
Gene: ENSMUSG00000022225

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Tryp_SPc 34 253 4.85e-73 SMART
Predicted Effect probably null
Transcript: ENSMUST00000022834
SMART Domains Protein: ENSMUSP00000022834
Gene: ENSMUSG00000022225

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Tryp_SPc 34 253 4.85e-73 SMART
Predicted Effect probably null
Transcript: ENSMUST00000226280
Predicted Effect probably null
Transcript: ENSMUST00000226280
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: This gene encodes a serine protease that belongs to the peptidase family S1. It is expressed in mast cells and is thought to function in the degradation of the extracellular matrix, the regulation of submucosal gland secretion, and the generation of vasoactive peptides. The encoded preproprotein undergoes proteolytic processing to generate a functional enzyme with elastase-like activity. Mice lacking the encoded protein exhibit significant attenuation of ischemia-reperfusion injury of the skeletal muscle. This gene is located in a cluster of related mast cell protease genes on chromosome 14. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display a reduction in mast cell-mediated ischemia reperfusion injury of skeletal muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A G 11: 117,806,324 T250A probably damaging Het
Acacb T C 5: 114,212,652 I1074T probably damaging Het
Acsl6 C A 11: 54,340,542 P462T probably damaging Het
Aebp1 A G 11: 5,871,842 D747G probably damaging Het
Antxr2 A C 5: 97,977,706 probably null Het
Arhgap35 T C 7: 16,563,467 T558A possibly damaging Het
Asap1 T A 15: 64,166,539 I223F possibly damaging Het
C2cd5 A C 6: 143,035,058 D669E probably damaging Het
Casz1 C T 4: 148,951,697 T1472M probably damaging Het
Catsper4 A G 4: 134,217,866 L154P probably damaging Het
Cep350 T C 1: 155,953,279 E293G probably benign Het
Ddx42 C T 11: 106,240,017 A439V probably damaging Het
Disp2 T A 2: 118,790,662 L625Q probably damaging Het
Dnah1 T C 14: 31,286,027 D2141G probably benign Het
Dsp T C 13: 38,192,406 I1389T probably damaging Het
Fam81a A T 9: 70,102,818 probably null Het
Fsip2 A G 2: 82,991,044 D5707G possibly damaging Het
Gcnt4 G A 13: 96,946,852 V219I probably benign Het
Gk2 A G 5: 97,456,280 V233A probably benign Het
Grm1 T C 10: 10,746,331 probably benign Het
Gsap T A 5: 21,281,540 V649D probably damaging Het
Kif1b G A 4: 149,237,532 H977Y possibly damaging Het
Ktn1 T A 14: 47,726,215 probably null Het
Lgals12 T A 19: 7,604,377 T29S probably benign Het
Me3 G T 7: 89,632,900 probably benign Het
Mgst3 T G 1: 167,378,305 K35T possibly damaging Het
Mtmr9 T C 14: 63,529,778 R354G probably benign Het
Myh11 T C 16: 14,215,874 E1059G probably damaging Het
Nr4a2 T A 2: 57,108,689 H408L probably damaging Het
Olfr689 A T 7: 105,314,246 T81S probably damaging Het
Olfr993 A T 2: 85,414,346 F178I probably damaging Het
Pds5b T A 5: 150,800,777 L1275Q possibly damaging Het
Pfkfb4 A G 9: 109,027,757 Y412C probably damaging Het
Pop1 T A 15: 34,529,058 C745S probably benign Het
Ptpn14 T G 1: 189,851,165 S736R probably benign Het
Rdh9 A T 10: 127,776,737 T85S possibly damaging Het
Rnf223 T C 4: 156,132,803 C212R probably damaging Het
Rnf39 A G 17: 36,943,338 E84G probably damaging Het
Sfmbt1 T A 14: 30,811,418 V584D probably damaging Het
Slc12a5 T A 2: 164,992,311 S728T probably damaging Het
Slc16a12 T A 19: 34,670,895 probably null Het
Snupn C A 9: 56,982,824 Q310K possibly damaging Het
St7 T C 6: 17,694,354 L48P probably damaging Het
Thsd7a T C 6: 12,379,573 N951D possibly damaging Het
Ttn G A 2: 76,852,069 R959* probably null Het
Ugt2b36 A T 5: 87,092,171 D118E probably benign Het
Vmn2r7 G A 3: 64,715,918 T327I probably damaging Het
Wdr70 T C 15: 8,079,251 D137G probably benign Het
Wrn A T 8: 33,353,332 M14K probably damaging Het
Xpot T A 10: 121,611,708 E283V probably benign Het
Other mutations in Cma1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Cma1 APN 14 55942697 missense probably benign 0.26
IGL02797:Cma1 APN 14 55943814 missense possibly damaging 0.58
R0026:Cma1 UTSW 14 55942164 missense probably damaging 1.00
R2029:Cma1 UTSW 14 55943734 missense possibly damaging 0.81
R2060:Cma1 UTSW 14 55943698 critical splice donor site probably null
R4994:Cma1 UTSW 14 55941671 missense probably damaging 1.00
R5275:Cma1 UTSW 14 55941700 missense probably damaging 1.00
R5794:Cma1 UTSW 14 55944520 missense probably benign
R5824:Cma1 UTSW 14 55941725 missense possibly damaging 0.79
R5955:Cma1 UTSW 14 55943769 missense probably benign 0.20
R5958:Cma1 UTSW 14 55941656 makesense probably null
R6075:Cma1 UTSW 14 55942314 missense probably damaging 0.97
R7088:Cma1 UTSW 14 55943816 missense probably damaging 1.00
R7139:Cma1 UTSW 14 55943816 missense probably damaging 1.00
R7220:Cma1 UTSW 14 55942663 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTCCAGGAGTACAATGGAGG -3'
(R):5'- TGAGCCTGTCACTGTCTCTG -3'

Sequencing Primer
(F):5'- GGAGAAGCCTGTTACCTTCAGTAGC -3'
(R):5'- TGTAGCTAAGGATGATGACCTTGAC -3'
Posted On2017-10-10