Incidental Mutation 'R6139:Wdr70'
ID 488507
Institutional Source Beutler Lab
Gene Symbol Wdr70
Ensembl Gene ENSMUSG00000039828
Gene Name WD repeat domain 70
Synonyms 4833422F06Rik
MMRRC Submission 044286-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.965) question?
Stock # R6139 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 7902536-8128693 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 8108735 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 137 (D137G)
Ref Sequence ENSEMBL: ENSMUSP00000037340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045766]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000045766
AA Change: D137G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000037340
Gene: ENSMUSG00000039828
AA Change: D137G

DomainStartEndE-ValueType
coiled coil region 51 81 N/A INTRINSIC
low complexity region 137 167 N/A INTRINSIC
WD40 174 213 1.61e-3 SMART
WD40 220 260 3.2e0 SMART
WD40 272 315 1.03e0 SMART
WD40 324 363 1.7e-2 SMART
WD40 367 409 1.38e-2 SMART
Blast:WD40 413 460 5e-16 BLAST
WD40 463 502 3.44e0 SMART
low complexity region 570 586 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A G 11: 117,697,150 (GRCm39) T250A probably damaging Het
Acacb T C 5: 114,350,713 (GRCm39) I1074T probably damaging Het
Acsl6 C A 11: 54,231,368 (GRCm39) P462T probably damaging Het
Aebp1 A G 11: 5,821,842 (GRCm39) D747G probably damaging Het
Antxr2 A C 5: 98,125,565 (GRCm39) probably null Het
Arhgap35 T C 7: 16,297,392 (GRCm39) T558A possibly damaging Het
Asap1 T A 15: 64,038,388 (GRCm39) I223F possibly damaging Het
C2cd5 A C 6: 142,980,784 (GRCm39) D669E probably damaging Het
Casz1 C T 4: 149,036,154 (GRCm39) T1472M probably damaging Het
Catsper4 A G 4: 133,945,177 (GRCm39) L154P probably damaging Het
Cep350 T C 1: 155,829,025 (GRCm39) E293G probably benign Het
Cma1 T A 14: 56,180,157 (GRCm39) probably null Het
Ddx42 C T 11: 106,130,843 (GRCm39) A439V probably damaging Het
Disp2 T A 2: 118,621,143 (GRCm39) L625Q probably damaging Het
Dnah1 T C 14: 31,007,984 (GRCm39) D2141G probably benign Het
Dsp T C 13: 38,376,382 (GRCm39) I1389T probably damaging Het
Fam81a A T 9: 70,010,100 (GRCm39) probably null Het
Fsip2 A G 2: 82,821,388 (GRCm39) D5707G possibly damaging Het
Gcnt4 G A 13: 97,083,360 (GRCm39) V219I probably benign Het
Gk2 A G 5: 97,604,139 (GRCm39) V233A probably benign Het
Grm1 T C 10: 10,622,075 (GRCm39) probably benign Het
Gsap T A 5: 21,486,538 (GRCm39) V649D probably damaging Het
Kif1b G A 4: 149,321,989 (GRCm39) H977Y possibly damaging Het
Ktn1 T A 14: 47,963,672 (GRCm39) probably null Het
Lgals12 T A 19: 7,581,742 (GRCm39) T29S probably benign Het
Me3 G T 7: 89,282,108 (GRCm39) probably benign Het
Mgst3 T G 1: 167,205,874 (GRCm39) K35T possibly damaging Het
Mtmr9 T C 14: 63,767,227 (GRCm39) R354G probably benign Het
Myh11 T C 16: 14,033,738 (GRCm39) E1059G probably damaging Het
Nr4a2 T A 2: 56,998,701 (GRCm39) H408L probably damaging Het
Or56b35 A T 7: 104,963,453 (GRCm39) T81S probably damaging Het
Or5ak23 A T 2: 85,244,690 (GRCm39) F178I probably damaging Het
Pds5b T A 5: 150,724,242 (GRCm39) L1275Q possibly damaging Het
Pfkfb4 A G 9: 108,856,825 (GRCm39) Y412C probably damaging Het
Pop1 T A 15: 34,529,204 (GRCm39) C745S probably benign Het
Ptpn14 T G 1: 189,583,362 (GRCm39) S736R probably benign Het
Rdh9 A T 10: 127,612,606 (GRCm39) T85S possibly damaging Het
Rnf223 T C 4: 156,217,260 (GRCm39) C212R probably damaging Het
Rnf39 A G 17: 37,254,230 (GRCm39) E84G probably damaging Het
Sfmbt1 T A 14: 30,533,375 (GRCm39) V584D probably damaging Het
Slc12a5 T A 2: 164,834,231 (GRCm39) S728T probably damaging Het
Slc16a12 T A 19: 34,648,295 (GRCm39) probably null Het
Snupn C A 9: 56,890,108 (GRCm39) Q310K possibly damaging Het
St7 T C 6: 17,694,353 (GRCm39) L48P probably damaging Het
Thsd7a T C 6: 12,379,572 (GRCm39) N951D possibly damaging Het
Ttn G A 2: 76,682,413 (GRCm39) R959* probably null Het
Ugt2b36 A T 5: 87,240,030 (GRCm39) D118E probably benign Het
Vmn2r7 G A 3: 64,623,339 (GRCm39) T327I probably damaging Het
Wrn A T 8: 33,843,360 (GRCm39) M14K probably damaging Het
Xpot T A 10: 121,447,613 (GRCm39) E283V probably benign Het
Other mutations in Wdr70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Wdr70 APN 15 8,049,088 (GRCm39) missense probably benign 0.07
IGL01121:Wdr70 APN 15 7,902,655 (GRCm39) missense possibly damaging 0.53
IGL01508:Wdr70 APN 15 8,108,747 (GRCm39) missense probably benign 0.33
IGL01801:Wdr70 APN 15 7,916,805 (GRCm39) splice site probably null
IGL01815:Wdr70 APN 15 7,916,805 (GRCm39) splice site probably null
IGL01929:Wdr70 APN 15 7,950,115 (GRCm39) splice site probably null
IGL02150:Wdr70 APN 15 8,112,030 (GRCm39) missense possibly damaging 0.72
IGL02245:Wdr70 APN 15 8,075,965 (GRCm39) missense possibly damaging 0.86
IGL02541:Wdr70 APN 15 7,913,783 (GRCm39) nonsense probably null
IGL02800:Wdr70 APN 15 8,111,980 (GRCm39) missense probably benign 0.25
IGL02829:Wdr70 APN 15 8,006,463 (GRCm39) missense possibly damaging 0.92
IGL02831:Wdr70 APN 15 7,913,787 (GRCm39) missense possibly damaging 0.86
IGL03169:Wdr70 APN 15 7,913,821 (GRCm39) missense possibly damaging 0.73
IGL03405:Wdr70 APN 15 8,065,352 (GRCm39) missense possibly damaging 0.73
R0106:Wdr70 UTSW 15 8,049,068 (GRCm39) critical splice donor site probably null
R0106:Wdr70 UTSW 15 8,049,068 (GRCm39) critical splice donor site probably null
R0462:Wdr70 UTSW 15 8,108,645 (GRCm39) missense probably benign 0.00
R0539:Wdr70 UTSW 15 7,915,118 (GRCm39) missense possibly damaging 0.96
R1398:Wdr70 UTSW 15 8,065,325 (GRCm39) missense probably benign 0.01
R1812:Wdr70 UTSW 15 8,108,663 (GRCm39) missense probably benign 0.00
R1863:Wdr70 UTSW 15 7,950,054 (GRCm39) missense probably benign 0.25
R1913:Wdr70 UTSW 15 7,913,891 (GRCm39) missense possibly damaging 0.72
R2425:Wdr70 UTSW 15 7,916,840 (GRCm39) nonsense probably null
R4013:Wdr70 UTSW 15 8,108,698 (GRCm39) nonsense probably null
R4015:Wdr70 UTSW 15 8,108,698 (GRCm39) nonsense probably null
R4017:Wdr70 UTSW 15 8,108,698 (GRCm39) nonsense probably null
R4111:Wdr70 UTSW 15 8,006,472 (GRCm39) missense probably benign 0.32
R5241:Wdr70 UTSW 15 8,108,700 (GRCm39) missense probably benign
R5277:Wdr70 UTSW 15 8,006,465 (GRCm39) nonsense probably null
R5306:Wdr70 UTSW 15 7,953,754 (GRCm39) missense probably benign 0.04
R5426:Wdr70 UTSW 15 7,951,586 (GRCm39) missense possibly damaging 0.59
R5586:Wdr70 UTSW 15 7,913,769 (GRCm39) missense possibly damaging 0.86
R6010:Wdr70 UTSW 15 7,916,900 (GRCm39) splice site probably null
R6035:Wdr70 UTSW 15 7,916,830 (GRCm39) missense possibly damaging 0.86
R6035:Wdr70 UTSW 15 7,916,830 (GRCm39) missense possibly damaging 0.86
R6109:Wdr70 UTSW 15 8,108,638 (GRCm39) splice site probably null
R6400:Wdr70 UTSW 15 8,072,322 (GRCm39) missense probably benign 0.32
R6456:Wdr70 UTSW 15 7,915,118 (GRCm39) missense possibly damaging 0.96
R6518:Wdr70 UTSW 15 8,108,821 (GRCm39) missense unknown
R7036:Wdr70 UTSW 15 7,913,855 (GRCm39) missense possibly damaging 0.85
R7056:Wdr70 UTSW 15 7,913,877 (GRCm39) missense possibly damaging 0.53
R7341:Wdr70 UTSW 15 7,953,725 (GRCm39) missense possibly damaging 0.71
R7484:Wdr70 UTSW 15 7,951,562 (GRCm39) missense probably benign 0.23
R7572:Wdr70 UTSW 15 8,065,327 (GRCm39) missense possibly damaging 0.85
R7652:Wdr70 UTSW 15 8,108,700 (GRCm39) missense probably benign
R7886:Wdr70 UTSW 15 8,108,733 (GRCm39) missense probably benign 0.02
R8103:Wdr70 UTSW 15 8,006,612 (GRCm39) missense possibly damaging 0.70
R8214:Wdr70 UTSW 15 7,916,851 (GRCm39) missense probably benign 0.03
R8252:Wdr70 UTSW 15 8,072,337 (GRCm39) splice site probably benign
R8869:Wdr70 UTSW 15 8,123,210 (GRCm39) missense probably benign 0.02
R9203:Wdr70 UTSW 15 7,902,684 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCCATGACTGTCAGCTTAGC -3'
(R):5'- ATAGGACAGGTGGGGTTTCC -3'

Sequencing Primer
(F):5'- CAGCTTAGCAGGAATTTGTTCTC -3'
(R):5'- TGTGCGCAGAGATGCCTAG -3'
Posted On 2017-10-10