Incidental Mutation 'R6139:Pop1'
ID 488508
Institutional Source Beutler Lab
Gene Symbol Pop1
Ensembl Gene ENSMUSG00000022325
Gene Name processing of precursor 1, ribonuclease P/MRP family, (S. cerevisiae)
Synonyms 4932434G09Rik
MMRRC Submission 044286-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock # R6139 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 34495304-34530648 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34529058 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 745 (C745S)
Ref Sequence ENSEMBL: ENSMUSP00000078037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052290] [ENSMUST00000079028]
AlphaFold Q8K205
Predicted Effect probably benign
Transcript: ENSMUST00000052290
AA Change: C775S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000052654
Gene: ENSMUSG00000022325
AA Change: C775S

DomainStartEndE-ValueType
Pfam:POP1 107 190 6.2e-21 PFAM
Pfam:POP1 179 257 2.5e-23 PFAM
low complexity region 382 387 N/A INTRINSIC
Pfam:POPLD 647 738 1.4e-30 PFAM
low complexity region 931 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079028
AA Change: C745S

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000078037
Gene: ENSMUSG00000022325
AA Change: C745S

DomainStartEndE-ValueType
Pfam:POP1 107 258 1e-46 PFAM
low complexity region 382 387 N/A INTRINSIC
Pfam:POPLD 617 708 1.2e-34 PFAM
low complexity region 901 910 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226504
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the protein subunit of two different small nucleolar ribonucleoprotein complexes: the endoribonuclease for mitochondrial RNA processing complex and the ribonuclease P complex. The encoded protein is a ribonuclease that localizes to the nucleus and functions in pre-RNA processing. This protein is also an autoantigen in patients suffering from connective tissue diseases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A G 11: 117,806,324 T250A probably damaging Het
Acacb T C 5: 114,212,652 I1074T probably damaging Het
Acsl6 C A 11: 54,340,542 P462T probably damaging Het
Aebp1 A G 11: 5,871,842 D747G probably damaging Het
Antxr2 A C 5: 97,977,706 probably null Het
Arhgap35 T C 7: 16,563,467 T558A possibly damaging Het
Asap1 T A 15: 64,166,539 I223F possibly damaging Het
C2cd5 A C 6: 143,035,058 D669E probably damaging Het
Casz1 C T 4: 148,951,697 T1472M probably damaging Het
Catsper4 A G 4: 134,217,866 L154P probably damaging Het
Cep350 T C 1: 155,953,279 E293G probably benign Het
Cma1 T A 14: 55,942,700 probably null Het
Ddx42 C T 11: 106,240,017 A439V probably damaging Het
Disp2 T A 2: 118,790,662 L625Q probably damaging Het
Dnah1 T C 14: 31,286,027 D2141G probably benign Het
Dsp T C 13: 38,192,406 I1389T probably damaging Het
Fam81a A T 9: 70,102,818 probably null Het
Fsip2 A G 2: 82,991,044 D5707G possibly damaging Het
Gcnt4 G A 13: 96,946,852 V219I probably benign Het
Gk2 A G 5: 97,456,280 V233A probably benign Het
Grm1 T C 10: 10,746,331 probably benign Het
Gsap T A 5: 21,281,540 V649D probably damaging Het
Kif1b G A 4: 149,237,532 H977Y possibly damaging Het
Ktn1 T A 14: 47,726,215 probably null Het
Lgals12 T A 19: 7,604,377 T29S probably benign Het
Me3 G T 7: 89,632,900 probably benign Het
Mgst3 T G 1: 167,378,305 K35T possibly damaging Het
Mtmr9 T C 14: 63,529,778 R354G probably benign Het
Myh11 T C 16: 14,215,874 E1059G probably damaging Het
Nr4a2 T A 2: 57,108,689 H408L probably damaging Het
Olfr689 A T 7: 105,314,246 T81S probably damaging Het
Olfr993 A T 2: 85,414,346 F178I probably damaging Het
Pds5b T A 5: 150,800,777 L1275Q possibly damaging Het
Pfkfb4 A G 9: 109,027,757 Y412C probably damaging Het
Ptpn14 T G 1: 189,851,165 S736R probably benign Het
Rdh9 A T 10: 127,776,737 T85S possibly damaging Het
Rnf223 T C 4: 156,132,803 C212R probably damaging Het
Rnf39 A G 17: 36,943,338 E84G probably damaging Het
Sfmbt1 T A 14: 30,811,418 V584D probably damaging Het
Slc12a5 T A 2: 164,992,311 S728T probably damaging Het
Slc16a12 T A 19: 34,670,895 probably null Het
Snupn C A 9: 56,982,824 Q310K possibly damaging Het
St7 T C 6: 17,694,354 L48P probably damaging Het
Thsd7a T C 6: 12,379,573 N951D possibly damaging Het
Ttn G A 2: 76,852,069 R959* probably null Het
Ugt2b36 A T 5: 87,092,171 D118E probably benign Het
Vmn2r7 G A 3: 64,715,918 T327I probably damaging Het
Wdr70 T C 15: 8,079,251 D137G probably benign Het
Wrn A T 8: 33,353,332 M14K probably damaging Het
Xpot T A 10: 121,611,708 E283V probably benign Het
Other mutations in Pop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Pop1 APN 15 34508729 missense probably benign 0.00
IGL02192:Pop1 APN 15 34529071 missense probably benign 0.08
IGL02680:Pop1 APN 15 34502473 missense probably damaging 0.99
IGL02958:Pop1 APN 15 34530363 missense probably damaging 0.99
H8562:Pop1 UTSW 15 34530212 missense probably benign 0.00
PIT4802001:Pop1 UTSW 15 34529083 missense probably benign 0.00
R0244:Pop1 UTSW 15 34515891 nonsense probably null
R0281:Pop1 UTSW 15 34529858 splice site probably null
R0453:Pop1 UTSW 15 34526206 missense possibly damaging 0.82
R0579:Pop1 UTSW 15 34509969 missense possibly damaging 0.68
R1054:Pop1 UTSW 15 34509809 missense probably benign 0.30
R1501:Pop1 UTSW 15 34510357 missense probably benign 0.01
R1614:Pop1 UTSW 15 34530210 missense possibly damaging 0.46
R1994:Pop1 UTSW 15 34530471 missense probably damaging 1.00
R2084:Pop1 UTSW 15 34508598 splice site probably benign
R4020:Pop1 UTSW 15 34508780 missense probably benign 0.01
R4550:Pop1 UTSW 15 34528936 missense probably damaging 1.00
R4579:Pop1 UTSW 15 34515824 intron probably benign
R5672:Pop1 UTSW 15 34530179 missense possibly damaging 0.63
R6161:Pop1 UTSW 15 34526310 missense probably damaging 1.00
R6821:Pop1 UTSW 15 34508639 missense possibly damaging 0.86
R7053:Pop1 UTSW 15 34530275 missense probably benign 0.01
R7195:Pop1 UTSW 15 34510379 missense probably damaging 0.97
R7543:Pop1 UTSW 15 34530447 missense probably damaging 1.00
R7571:Pop1 UTSW 15 34528947 missense probably null 1.00
R7587:Pop1 UTSW 15 34502413 missense probably damaging 0.97
R8401:Pop1 UTSW 15 34508609 missense probably damaging 1.00
R8406:Pop1 UTSW 15 34529170 missense probably benign
R8707:Pop1 UTSW 15 34529203 missense probably benign 0.02
R9044:Pop1 UTSW 15 34530408 missense possibly damaging 0.94
R9066:Pop1 UTSW 15 34515914 missense possibly damaging 0.68
R9236:Pop1 UTSW 15 34499412 missense probably damaging 0.98
RF001:Pop1 UTSW 15 34502437 missense probably damaging 1.00
RF002:Pop1 UTSW 15 34502437 missense probably damaging 1.00
Z1088:Pop1 UTSW 15 34499319 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGCTAAAAGGCCCAACTATG -3'
(R):5'- TACCCAGAGCCTGTTCAATATG -3'

Sequencing Primer
(F):5'- AGGCCCAACTATGTTAAGCTTGG -3'
(R):5'- TTCAAAATGTACCTGGCAGCTGC -3'
Posted On 2017-10-10