Incidental Mutation 'R6140:Il18rap'
ID488514
Institutional Source Beutler Lab
Gene Symbol Il18rap
Ensembl Gene ENSMUSG00000026068
Gene Nameinterleukin 18 receptor accessory protein
SynonymsAcPL accessory protein-like)
MMRRC Submission 044287-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6140 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location40515362-40551705 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 40525052 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 110 (M110R)
Ref Sequence ENSEMBL: ENSMUSP00000027237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027237]
Predicted Effect probably benign
Transcript: ENSMUST00000027237
AA Change: M110R

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000027237
Gene: ENSMUSG00000026068
AA Change: M110R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:IG_like 31 144 2e-36 BLAST
IG 159 240 2.94e0 SMART
IG 257 354 1.35e0 SMART
transmembrane domain 363 385 N/A INTRINSIC
TIR 406 561 3.68e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163057
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.2%
  • 10x: 96.9%
  • 20x: 91.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: Interleukin-18 (or interferon-gamma inducing factor) is a proinflammatory cytokine that induces cell-mediated immunity following microbial infection. This gene encodes a member of the interleukin-1 receptor family. The encoded protein is an accessory subunit of the receptor for interleukin-18 and mediates signaling through this cytokine. Mice lacking this gene exhibit a defective cell-mediated immune response. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mice exhibit defective IL-18-mediated immune responses such as the inability of splenocytes, T helper 1 cells and neutrophils to produce cytokines in response to IL-18. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T C 12: 17,005,922 probably benign Het
Adgra2 A T 8: 27,115,405 R593W probably damaging Het
Agfg2 T C 5: 137,667,085 Q136R probably damaging Het
Ankrd42 T C 7: 92,591,828 probably null Het
Baz2b T C 2: 59,912,527 D1643G probably damaging Het
Ccdc171 C T 4: 83,696,317 Q1060* probably null Het
Cela1 C T 15: 100,681,156 R207H probably benign Het
Clic6 A G 16: 92,539,492 R563G probably damaging Het
Cspg4 A T 9: 56,897,224 H1773L probably benign Het
Ddrgk1 A G 2: 130,658,614 V204A probably benign Het
Dhrs7c A T 11: 67,815,074 T218S probably damaging Het
Dlgap4 A T 2: 156,762,729 probably null Het
Gm4788 A G 1: 139,732,395 V664A probably damaging Het
Hgd A T 16: 37,589,713 Y37F probably benign Het
Hmcn1 A C 1: 150,732,846 N1528K probably damaging Het
Hps3 A G 3: 19,996,987 F843S probably damaging Het
Ifih1 A G 2: 62,601,460 F800S possibly damaging Het
Igsf21 T A 4: 140,107,373 T63S probably benign Het
Kcnk2 G T 1: 189,209,907 H384Q probably damaging Het
Lima1 C T 15: 99,781,058 V341M probably damaging Het
Lins1 T C 7: 66,711,924 L441P probably damaging Het
Lss T C 10: 76,550,688 Y642H probably damaging Het
Mrc2 A G 11: 105,346,789 T1098A probably benign Het
Nf1 T A 11: 79,473,320 probably null Het
Nrd1 G T 4: 109,049,111 A730S probably damaging Het
Nup214 C T 2: 32,051,796 T72I possibly damaging Het
Olfr1082 A T 2: 86,594,104 C241* probably null Het
Olfr806 T G 10: 129,738,654 K88Q possibly damaging Het
Olfr952 A G 9: 39,426,247 S275P possibly damaging Het
Oxt A G 2: 130,576,271 Y21C probably damaging Het
Pla2g12b G A 10: 59,421,441 probably benign Het
Ralgapb T C 2: 158,456,572 V907A probably damaging Het
Rnls A T 19: 33,138,200 D157E probably damaging Het
Slc7a14 C A 3: 31,237,548 V194L probably benign Het
Slc7a7 G A 14: 54,379,058 T189I probably damaging Het
Snupn C A 9: 56,982,824 Q310K possibly damaging Het
Ssh1 A G 5: 113,942,631 Y891H probably benign Het
Suclg2 T C 6: 95,569,721 D258G probably damaging Het
Tpk1 A T 6: 43,423,701 M129K probably benign Het
Ubr3 A G 2: 69,973,329 I1088V probably benign Het
Vmn1r3 A G 4: 3,185,031 I92T probably damaging Het
Vmn2r69 G A 7: 85,411,449 S309F probably damaging Het
Wsb1 A T 11: 79,241,618 H325Q probably damaging Het
Zfp263 A G 16: 3,748,217 S281G probably benign Het
Zfp507 A G 7: 35,794,188 S477P probably damaging Het
Other mutations in Il18rap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Il18rap APN 1 40541921 missense probably benign 0.03
IGL01467:Il18rap APN 1 40548639 missense probably damaging 1.00
IGL01505:Il18rap APN 1 40537084 missense probably damaging 0.97
IGL02215:Il18rap APN 1 40547922 missense probably damaging 1.00
IGL03307:Il18rap APN 1 40543067 missense probably benign 0.01
R0136:Il18rap UTSW 1 40525058 missense probably benign 0.04
R0299:Il18rap UTSW 1 40525058 missense probably benign 0.04
R0358:Il18rap UTSW 1 40549042 missense possibly damaging 0.53
R0499:Il18rap UTSW 1 40525058 missense probably benign 0.04
R0830:Il18rap UTSW 1 40542990 missense probably damaging 1.00
R1386:Il18rap UTSW 1 40531522 missense probably benign 0.00
R1817:Il18rap UTSW 1 40531527 missense probably benign 0.04
R1818:Il18rap UTSW 1 40531527 missense probably benign 0.04
R1819:Il18rap UTSW 1 40531527 missense probably benign 0.04
R3721:Il18rap UTSW 1 40537088 missense probably damaging 1.00
R5634:Il18rap UTSW 1 40539376 intron probably benign
R5663:Il18rap UTSW 1 40531557 missense probably damaging 1.00
R5690:Il18rap UTSW 1 40537112 missense possibly damaging 0.73
R5825:Il18rap UTSW 1 40531566 missense probably benign 0.38
R6291:Il18rap UTSW 1 40524889 missense probably benign 0.00
R6859:Il18rap UTSW 1 40525095 nonsense probably null
R6992:Il18rap UTSW 1 40542035 missense probably benign 0.00
R7317:Il18rap UTSW 1 40525376 missense probably damaging 0.98
R7402:Il18rap UTSW 1 40524951 missense probably benign 0.01
R7465:Il18rap UTSW 1 40543089 missense probably damaging 1.00
R7561:Il18rap UTSW 1 40524377 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGGGTGCAGAGAATTTTGTC -3'
(R):5'- AGACTGTCTTGATACAACAGGC -3'

Sequencing Primer
(F):5'- TGTGACTTACAAGAGCTTCAGG -3'
(R):5'- CTGTCTTGATACAACAGGCCATATC -3'
Posted On2017-10-10