Incidental Mutation 'R6140:Slc7a14'
ID488528
Institutional Source Beutler Lab
Gene Symbol Slc7a14
Ensembl Gene ENSMUSG00000069072
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 14
Synonyms
MMRRC Submission 044287-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R6140 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location31202858-31310378 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 31237548 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 194 (V194L)
Ref Sequence ENSEMBL: ENSMUSP00000103880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091259] [ENSMUST00000108245]
Predicted Effect probably benign
Transcript: ENSMUST00000091259
AA Change: V194L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088803
Gene: ENSMUSG00000069072
AA Change: V194L

DomainStartEndE-ValueType
Pfam:AA_permease_2 53 443 2.1e-44 PFAM
Pfam:AA_permease 57 436 7.2e-38 PFAM
transmembrane domain 563 585 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Pfam:AA_permease_C 627 677 9.2e-21 PFAM
low complexity region 737 757 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108245
AA Change: V194L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103880
Gene: ENSMUSG00000069072
AA Change: V194L

DomainStartEndE-ValueType
Pfam:AA_permease_2 53 445 2.5e-46 PFAM
Pfam:AA_permease 57 437 6.9e-41 PFAM
transmembrane domain 563 585 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Pfam:AA_permease_C 627 668 1.4e-17 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.2%
  • 10x: 96.9%
  • 20x: 91.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predicted to encode a glycosylated, cationic amino acid transporter protein with 14 transmembrane domains. This gene is primarily expressed in skin fibroblasts, neural tissue, and primary endothelial cells and its protein is predicted to mediate lysosomal uptake of cationic amino acids. Mutations in this gene are associated with autosomal recessive retinitis pigmentosa. In mice, this gene is expressed in the photoreceptor layer of the retina where its expression increases over the course of retinal development and persists in the mature retina. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal eye electrophysiology, thin retinal outer nuclear and decreased total retinal thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T C 12: 17,005,922 probably benign Het
Adgra2 A T 8: 27,115,405 R593W probably damaging Het
Agfg2 T C 5: 137,667,085 Q136R probably damaging Het
Ankrd42 T C 7: 92,591,828 probably null Het
Baz2b T C 2: 59,912,527 D1643G probably damaging Het
Ccdc171 C T 4: 83,696,317 Q1060* probably null Het
Cela1 C T 15: 100,681,156 R207H probably benign Het
Clic6 A G 16: 92,539,492 R563G probably damaging Het
Cspg4 A T 9: 56,897,224 H1773L probably benign Het
Ddrgk1 A G 2: 130,658,614 V204A probably benign Het
Dhrs7c A T 11: 67,815,074 T218S probably damaging Het
Dlgap4 A T 2: 156,762,729 probably null Het
Gm4788 A G 1: 139,732,395 V664A probably damaging Het
Hgd A T 16: 37,589,713 Y37F probably benign Het
Hmcn1 A C 1: 150,732,846 N1528K probably damaging Het
Hps3 A G 3: 19,996,987 F843S probably damaging Het
Ifih1 A G 2: 62,601,460 F800S possibly damaging Het
Igsf21 T A 4: 140,107,373 T63S probably benign Het
Il18rap T G 1: 40,525,052 M110R probably benign Het
Kcnk2 G T 1: 189,209,907 H384Q probably damaging Het
Lima1 C T 15: 99,781,058 V341M probably damaging Het
Lins1 T C 7: 66,711,924 L441P probably damaging Het
Lss T C 10: 76,550,688 Y642H probably damaging Het
Mrc2 A G 11: 105,346,789 T1098A probably benign Het
Nf1 T A 11: 79,473,320 probably null Het
Nrd1 G T 4: 109,049,111 A730S probably damaging Het
Nup214 C T 2: 32,051,796 T72I possibly damaging Het
Olfr1082 A T 2: 86,594,104 C241* probably null Het
Olfr806 T G 10: 129,738,654 K88Q possibly damaging Het
Olfr952 A G 9: 39,426,247 S275P possibly damaging Het
Oxt A G 2: 130,576,271 Y21C probably damaging Het
Pla2g12b G A 10: 59,421,441 probably benign Het
Ralgapb T C 2: 158,456,572 V907A probably damaging Het
Rnls A T 19: 33,138,200 D157E probably damaging Het
Slc7a7 G A 14: 54,379,058 T189I probably damaging Het
Snupn C A 9: 56,982,824 Q310K possibly damaging Het
Ssh1 A G 5: 113,942,631 Y891H probably benign Het
Suclg2 T C 6: 95,569,721 D258G probably damaging Het
Tpk1 A T 6: 43,423,701 M129K probably benign Het
Ubr3 A G 2: 69,973,329 I1088V probably benign Het
Vmn1r3 A G 4: 3,185,031 I92T probably damaging Het
Vmn2r69 G A 7: 85,411,449 S309F probably damaging Het
Wsb1 A T 11: 79,241,618 H325Q probably damaging Het
Zfp263 A G 16: 3,748,217 S281G probably benign Het
Zfp507 A G 7: 35,794,188 S477P probably damaging Het
Other mutations in Slc7a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02631:Slc7a14 APN 3 31238678 missense probably damaging 1.00
IGL02713:Slc7a14 APN 3 31257763 missense probably damaging 0.96
IGL03341:Slc7a14 APN 3 31238770 missense probably damaging 1.00
IGL03350:Slc7a14 APN 3 31237409 missense probably benign 0.35
IGL03379:Slc7a14 APN 3 31223515 missense probably damaging 1.00
R0064:Slc7a14 UTSW 3 31227060 missense probably damaging 1.00
R1549:Slc7a14 UTSW 3 31224118 missense possibly damaging 0.94
R1591:Slc7a14 UTSW 3 31237449 missense probably damaging 1.00
R2054:Slc7a14 UTSW 3 31237362 splice site probably benign
R2057:Slc7a14 UTSW 3 31237496 missense probably damaging 1.00
R2442:Slc7a14 UTSW 3 31230320 missense probably damaging 1.00
R2504:Slc7a14 UTSW 3 31237501 missense possibly damaging 0.85
R3848:Slc7a14 UTSW 3 31237474 missense probably damaging 1.00
R4653:Slc7a14 UTSW 3 31257682 missense probably damaging 1.00
R4702:Slc7a14 UTSW 3 31230398 missense probably damaging 1.00
R5043:Slc7a14 UTSW 3 31237466 missense probably damaging 1.00
R5187:Slc7a14 UTSW 3 31237365 splice site probably null
R5345:Slc7a14 UTSW 3 31223857 missense probably damaging 0.99
R5393:Slc7a14 UTSW 3 31257770 missense probably damaging 1.00
R5421:Slc7a14 UTSW 3 31224197 missense probably damaging 1.00
R5736:Slc7a14 UTSW 3 31223910 missense probably benign 0.00
R5771:Slc7a14 UTSW 3 31238707 missense probably damaging 1.00
R5896:Slc7a14 UTSW 3 31257570 missense probably damaging 1.00
R5996:Slc7a14 UTSW 3 31209236 missense probably benign
R6020:Slc7a14 UTSW 3 31224112 missense probably benign
R6107:Slc7a14 UTSW 3 31257610 missense probably damaging 1.00
R6491:Slc7a14 UTSW 3 31223944 missense probably damaging 1.00
R6846:Slc7a14 UTSW 3 31224223 missense probably damaging 1.00
R6990:Slc7a14 UTSW 3 31223579 missense possibly damaging 0.90
R7184:Slc7a14 UTSW 3 31227063 missense probably damaging 0.98
R7271:Slc7a14 UTSW 3 31224235 missense probably damaging 1.00
R7282:Slc7a14 UTSW 3 31227153 missense possibly damaging 0.67
R7331:Slc7a14 UTSW 3 31257731 missense probably benign 0.00
Z1088:Slc7a14 UTSW 3 31223999 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGGAAGACACTCAGGATTCTG -3'
(R):5'- ATCTGCTTATGGACCATAGCAG -3'

Sequencing Primer
(F):5'- GGATTCTGAGAATAAACTCACCCCTG -3'
(R):5'- GCTTATGGACCATAGCAGTAACATG -3'
Posted On2017-10-10