Incidental Mutation 'R6140:Vmn1r3'
ID488529
Institutional Source Beutler Lab
Gene Symbol Vmn1r3
Ensembl Gene ENSMUSG00000115466
Gene Namevomeronasal 1 receptor 3
SynonymsGm11778
MMRRC Submission 044287-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock #R6140 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location3184348-3185358 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3185031 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 92 (I92T)
Ref Sequence ENSEMBL: ENSMUSP00000100790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105159]
Predicted Effect probably damaging
Transcript: ENSMUST00000105159
AA Change: I92T

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000100790
Gene: ENSMUSG00000115466
AA Change: I92T

DomainStartEndE-ValueType
Pfam:TAS2R 6 302 1.7e-9 PFAM
Pfam:7tm_1 30 292 5.1e-7 PFAM
Pfam:V1R 34 298 1.2e-35 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.2%
  • 10x: 96.9%
  • 20x: 91.8%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T C 12: 17,005,922 probably benign Het
Adgra2 A T 8: 27,115,405 R593W probably damaging Het
Agfg2 T C 5: 137,667,085 Q136R probably damaging Het
Ankrd42 T C 7: 92,591,828 probably null Het
Baz2b T C 2: 59,912,527 D1643G probably damaging Het
Ccdc171 C T 4: 83,696,317 Q1060* probably null Het
Cela1 C T 15: 100,681,156 R207H probably benign Het
Clic6 A G 16: 92,539,492 R563G probably damaging Het
Cspg4 A T 9: 56,897,224 H1773L probably benign Het
Ddrgk1 A G 2: 130,658,614 V204A probably benign Het
Dhrs7c A T 11: 67,815,074 T218S probably damaging Het
Dlgap4 A T 2: 156,762,729 probably null Het
Gm4788 A G 1: 139,732,395 V664A probably damaging Het
Hgd A T 16: 37,589,713 Y37F probably benign Het
Hmcn1 A C 1: 150,732,846 N1528K probably damaging Het
Hps3 A G 3: 19,996,987 F843S probably damaging Het
Ifih1 A G 2: 62,601,460 F800S possibly damaging Het
Igsf21 T A 4: 140,107,373 T63S probably benign Het
Il18rap T G 1: 40,525,052 M110R probably benign Het
Kcnk2 G T 1: 189,209,907 H384Q probably damaging Het
Lima1 C T 15: 99,781,058 V341M probably damaging Het
Lins1 T C 7: 66,711,924 L441P probably damaging Het
Lss T C 10: 76,550,688 Y642H probably damaging Het
Mrc2 A G 11: 105,346,789 T1098A probably benign Het
Nf1 T A 11: 79,473,320 probably null Het
Nrd1 G T 4: 109,049,111 A730S probably damaging Het
Nup214 C T 2: 32,051,796 T72I possibly damaging Het
Olfr1082 A T 2: 86,594,104 C241* probably null Het
Olfr806 T G 10: 129,738,654 K88Q possibly damaging Het
Olfr952 A G 9: 39,426,247 S275P possibly damaging Het
Oxt A G 2: 130,576,271 Y21C probably damaging Het
Pla2g12b G A 10: 59,421,441 probably benign Het
Ralgapb T C 2: 158,456,572 V907A probably damaging Het
Rnls A T 19: 33,138,200 D157E probably damaging Het
Slc7a14 C A 3: 31,237,548 V194L probably benign Het
Slc7a7 G A 14: 54,379,058 T189I probably damaging Het
Snupn C A 9: 56,982,824 Q310K possibly damaging Het
Ssh1 A G 5: 113,942,631 Y891H probably benign Het
Suclg2 T C 6: 95,569,721 D258G probably damaging Het
Tpk1 A T 6: 43,423,701 M129K probably benign Het
Ubr3 A G 2: 69,973,329 I1088V probably benign Het
Vmn2r69 G A 7: 85,411,449 S309F probably damaging Het
Wsb1 A T 11: 79,241,618 H325Q probably damaging Het
Zfp263 A G 16: 3,748,217 S281G probably benign Het
Zfp507 A G 7: 35,794,188 S477P probably damaging Het
Other mutations in Vmn1r3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03130:Vmn1r3 APN 4 3185214 missense possibly damaging 0.89
PIT4131001:Vmn1r3 UTSW 4 3184691 missense probably damaging 1.00
PIT4131001:Vmn1r3 UTSW 4 3184774 missense probably benign 0.02
PIT4142001:Vmn1r3 UTSW 4 3184691 missense probably damaging 1.00
PIT4142001:Vmn1r3 UTSW 4 3184774 missense probably benign 0.02
R0972:Vmn1r3 UTSW 4 3185125 missense probably damaging 1.00
R1423:Vmn1r3 UTSW 4 3185231 missense probably damaging 1.00
R3902:Vmn1r3 UTSW 4 3185241 missense probably benign 0.41
R4999:Vmn1r3 UTSW 4 3185009 nonsense probably null
R6091:Vmn1r3 UTSW 4 3184684 missense probably damaging 0.97
R6188:Vmn1r3 UTSW 4 3185017 missense probably damaging 1.00
R6299:Vmn1r3 UTSW 4 3185098 missense possibly damaging 0.95
R6303:Vmn1r3 UTSW 4 3184975 missense probably damaging 1.00
R6304:Vmn1r3 UTSW 4 3184975 missense probably damaging 1.00
R6317:Vmn1r3 UTSW 4 3184993 missense probably benign 0.39
R6430:Vmn1r3 UTSW 4 3184971 missense probably benign
R6633:Vmn1r3 UTSW 4 3184971 missense probably benign
Z1177:Vmn1r3 UTSW 4 3185304 start codon destroyed probably null 0.60
Predicted Primers PCR Primer
(F):5'- GCCTGATTCTCTTAGTGGAGTC -3'
(R):5'- GGAATGTTTGGCAATTCCTCAATC -3'

Sequencing Primer
(F):5'- TCAAGATGTTTAGAAGCAGGTGCAC -3'
(R):5'- TCGCCAACTACTTGACTG -3'
Posted On2017-10-10