Incidental Mutation 'R6140:Ssh1'
ID488532
Institutional Source Beutler Lab
Gene Symbol Ssh1
Ensembl Gene ENSMUSG00000042121
Gene Nameslingshot protein phosphatase 1
SynonymsmSSH-1L, LOC384311
MMRRC Submission 044287-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6140 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location113937094-113993894 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113942631 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 891 (Y891H)
Ref Sequence ENSEMBL: ENSMUSP00000107917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077689] [ENSMUST00000112298] [ENSMUST00000159592]
Predicted Effect probably benign
Transcript: ENSMUST00000077689
AA Change: Y870H

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000076873
Gene: ENSMUSG00000042121
AA Change: Y870H

DomainStartEndE-ValueType
Pfam:DEK_C 208 261 1.1e-19 PFAM
DSPc 265 403 7.82e-47 SMART
low complexity region 490 503 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 686 704 N/A INTRINSIC
low complexity region 732 748 N/A INTRINSIC
low complexity region 874 892 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112298
AA Change: Y891H

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107917
Gene: ENSMUSG00000042121
AA Change: Y891H

DomainStartEndE-ValueType
low complexity region 13 22 N/A INTRINSIC
Pfam:DEK_C 229 282 9.5e-20 PFAM
DSPc 286 424 7.82e-47 SMART
low complexity region 511 524 N/A INTRINSIC
low complexity region 675 690 N/A INTRINSIC
low complexity region 707 725 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
low complexity region 895 913 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159592
AA Change: Y913H

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000124312
Gene: ENSMUSG00000042121
AA Change: Y913H

DomainStartEndE-ValueType
low complexity region 13 22 N/A INTRINSIC
Pfam:DEK_C 252 303 2.3e-17 PFAM
DSPc 308 446 7.82e-47 SMART
low complexity region 533 546 N/A INTRINSIC
low complexity region 697 712 N/A INTRINSIC
low complexity region 729 747 N/A INTRINSIC
low complexity region 775 791 N/A INTRINSIC
low complexity region 917 935 N/A INTRINSIC
Meta Mutation Damage Score 0.0638 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.2%
  • 10x: 96.9%
  • 20x: 91.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the slingshot homolog (SSH) family of phosphatases, which regulate actin filament dynamics. The SSH proteins dephosphorylate and activate the actin binding/depolymerizing factor cofilin, which subsequently binds to actin filaments and stimulates their disassembly. Cofilin is inactivated by kinases such as LIM domain kinase-1 (LIMK1), which may also be dephosphorylated and inactivated by SSH proteins. The SSH family thus appears to play a role in actin dynamics by reactivating cofilin proteins. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T C 12: 17,005,922 probably benign Het
Adgra2 A T 8: 27,115,405 R593W probably damaging Het
Agfg2 T C 5: 137,667,085 Q136R probably damaging Het
Ankrd42 T C 7: 92,591,828 probably null Het
Baz2b T C 2: 59,912,527 D1643G probably damaging Het
Ccdc171 C T 4: 83,696,317 Q1060* probably null Het
Cela1 C T 15: 100,681,156 R207H probably benign Het
Clic6 A G 16: 92,539,492 R563G probably damaging Het
Cspg4 A T 9: 56,897,224 H1773L probably benign Het
Ddrgk1 A G 2: 130,658,614 V204A probably benign Het
Dhrs7c A T 11: 67,815,074 T218S probably damaging Het
Dlgap4 A T 2: 156,762,729 probably null Het
Gm4788 A G 1: 139,732,395 V664A probably damaging Het
Hgd A T 16: 37,589,713 Y37F probably benign Het
Hmcn1 A C 1: 150,732,846 N1528K probably damaging Het
Hps3 A G 3: 19,996,987 F843S probably damaging Het
Ifih1 A G 2: 62,601,460 F800S possibly damaging Het
Igsf21 T A 4: 140,107,373 T63S probably benign Het
Il18rap T G 1: 40,525,052 M110R probably benign Het
Kcnk2 G T 1: 189,209,907 H384Q probably damaging Het
Lima1 C T 15: 99,781,058 V341M probably damaging Het
Lins1 T C 7: 66,711,924 L441P probably damaging Het
Lss T C 10: 76,550,688 Y642H probably damaging Het
Mrc2 A G 11: 105,346,789 T1098A probably benign Het
Nf1 T A 11: 79,473,320 probably null Het
Nrd1 G T 4: 109,049,111 A730S probably damaging Het
Nup214 C T 2: 32,051,796 T72I possibly damaging Het
Olfr1082 A T 2: 86,594,104 C241* probably null Het
Olfr806 T G 10: 129,738,654 K88Q possibly damaging Het
Olfr952 A G 9: 39,426,247 S275P possibly damaging Het
Oxt A G 2: 130,576,271 Y21C probably damaging Het
Pla2g12b G A 10: 59,421,441 probably benign Het
Ralgapb T C 2: 158,456,572 V907A probably damaging Het
Rnls A T 19: 33,138,200 D157E probably damaging Het
Slc7a14 C A 3: 31,237,548 V194L probably benign Het
Slc7a7 G A 14: 54,379,058 T189I probably damaging Het
Snupn C A 9: 56,982,824 Q310K possibly damaging Het
Suclg2 T C 6: 95,569,721 D258G probably damaging Het
Tpk1 A T 6: 43,423,701 M129K probably benign Het
Ubr3 A G 2: 69,973,329 I1088V probably benign Het
Vmn1r3 A G 4: 3,185,031 I92T probably damaging Het
Vmn2r69 G A 7: 85,411,449 S309F probably damaging Het
Wsb1 A T 11: 79,241,618 H325Q probably damaging Het
Zfp263 A G 16: 3,748,217 S281G probably benign Het
Zfp507 A G 7: 35,794,188 S477P probably damaging Het
Other mutations in Ssh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Ssh1 APN 5 113942576 missense probably damaging 1.00
IGL01432:Ssh1 APN 5 113958822 missense probably benign 0.31
IGL01933:Ssh1 APN 5 113950380 splice site probably benign
IGL01951:Ssh1 APN 5 113966247 missense possibly damaging 0.64
IGL02117:Ssh1 APN 5 113946480 nonsense probably null
IGL02391:Ssh1 APN 5 113942517 missense probably damaging 1.00
R0110:Ssh1 UTSW 5 113946705 missense probably benign 0.00
R0469:Ssh1 UTSW 5 113946705 missense probably benign 0.00
R0510:Ssh1 UTSW 5 113946705 missense probably benign 0.00
R0682:Ssh1 UTSW 5 113960657 missense probably damaging 1.00
R0863:Ssh1 UTSW 5 113966731 missense probably damaging 1.00
R0939:Ssh1 UTSW 5 113970436 missense probably damaging 1.00
R1539:Ssh1 UTSW 5 113952003 missense probably damaging 1.00
R1716:Ssh1 UTSW 5 113952020 missense possibly damaging 0.80
R1754:Ssh1 UTSW 5 113955845 missense probably damaging 0.99
R1867:Ssh1 UTSW 5 113943451 missense probably damaging 1.00
R2261:Ssh1 UTSW 5 113942703 missense possibly damaging 0.94
R2262:Ssh1 UTSW 5 113942703 missense possibly damaging 0.94
R2497:Ssh1 UTSW 5 113958858 missense probably damaging 1.00
R3774:Ssh1 UTSW 5 113966722 missense probably damaging 1.00
R3922:Ssh1 UTSW 5 113942708 missense possibly damaging 0.52
R5120:Ssh1 UTSW 5 113957398 missense possibly damaging 0.89
R5283:Ssh1 UTSW 5 113950545 missense probably damaging 1.00
R5810:Ssh1 UTSW 5 113946566 missense probably benign 0.05
R5877:Ssh1 UTSW 5 113943120 missense probably benign 0.29
R6360:Ssh1 UTSW 5 113961347 splice site probably null
R6612:Ssh1 UTSW 5 113958730 missense probably benign 0.43
R6819:Ssh1 UTSW 5 113946790 missense probably benign
R6855:Ssh1 UTSW 5 113942575 missense probably damaging 1.00
R7389:Ssh1 UTSW 5 113958831 missense probably benign 0.28
R7470:Ssh1 UTSW 5 113942427 missense possibly damaging 0.63
R7568:Ssh1 UTSW 5 113957380 splice site probably null
R7647:Ssh1 UTSW 5 113942958 missense probably benign 0.00
R7649:Ssh1 UTSW 5 113950551 missense probably benign 0.12
R7754:Ssh1 UTSW 5 113966234 missense probably benign 0.31
R7887:Ssh1 UTSW 5 113961349 critical splice donor site probably null
R7970:Ssh1 UTSW 5 113961349 critical splice donor site probably null
Z1177:Ssh1 UTSW 5 113966294 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AATGGGACCTTTTCAGCGGG -3'
(R):5'- GTTGAAGAGCCTGCCTTCAG -3'

Sequencing Primer
(F):5'- GGACGACACGGTGAGGC -3'
(R):5'- GCCTTCAGACTCACCAGCTG -3'
Posted On2017-10-10