Incidental Mutation 'R6140:Tpk1'
ID488534
Institutional Source Beutler Lab
Gene Symbol Tpk1
Ensembl Gene ENSMUSG00000029735
Gene Namethiamine pyrophosphokinase
Synonyms
MMRRC Submission 044287-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6140 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location43345001-43666278 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43423701 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 129 (M129K)
Ref Sequence ENSEMBL: ENSMUSP00000110291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067888] [ENSMUST00000114644]
Predicted Effect probably benign
Transcript: ENSMUST00000067888
AA Change: M178K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000065631
Gene: ENSMUSG00000029735
AA Change: M178K

DomainStartEndE-ValueType
Pfam:TPK_catalytic 30 155 2.4e-44 PFAM
TPK_B1_binding 168 235 5.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114644
AA Change: M129K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000110291
Gene: ENSMUSG00000029735
AA Change: M129K

DomainStartEndE-ValueType
TPK_B1_binding 119 186 5.12e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203649
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.2%
  • 10x: 96.9%
  • 20x: 91.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein, that exists as a homodimer, which catalyzes the conversion of thiamine to thiamine pyrophosphate. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T C 12: 17,005,922 probably benign Het
Adgra2 A T 8: 27,115,405 R593W probably damaging Het
Agfg2 T C 5: 137,667,085 Q136R probably damaging Het
Ankrd42 T C 7: 92,591,828 probably null Het
Baz2b T C 2: 59,912,527 D1643G probably damaging Het
Ccdc171 C T 4: 83,696,317 Q1060* probably null Het
Cela1 C T 15: 100,681,156 R207H probably benign Het
Clic6 A G 16: 92,539,492 R563G probably damaging Het
Cspg4 A T 9: 56,897,224 H1773L probably benign Het
Ddrgk1 A G 2: 130,658,614 V204A probably benign Het
Dhrs7c A T 11: 67,815,074 T218S probably damaging Het
Dlgap4 A T 2: 156,762,729 probably null Het
Gm4788 A G 1: 139,732,395 V664A probably damaging Het
Hgd A T 16: 37,589,713 Y37F probably benign Het
Hmcn1 A C 1: 150,732,846 N1528K probably damaging Het
Hps3 A G 3: 19,996,987 F843S probably damaging Het
Ifih1 A G 2: 62,601,460 F800S possibly damaging Het
Igsf21 T A 4: 140,107,373 T63S probably benign Het
Il18rap T G 1: 40,525,052 M110R probably benign Het
Kcnk2 G T 1: 189,209,907 H384Q probably damaging Het
Lima1 C T 15: 99,781,058 V341M probably damaging Het
Lins1 T C 7: 66,711,924 L441P probably damaging Het
Lss T C 10: 76,550,688 Y642H probably damaging Het
Mrc2 A G 11: 105,346,789 T1098A probably benign Het
Nf1 T A 11: 79,473,320 probably null Het
Nrd1 G T 4: 109,049,111 A730S probably damaging Het
Nup214 C T 2: 32,051,796 T72I possibly damaging Het
Olfr1082 A T 2: 86,594,104 C241* probably null Het
Olfr806 T G 10: 129,738,654 K88Q possibly damaging Het
Olfr952 A G 9: 39,426,247 S275P possibly damaging Het
Oxt A G 2: 130,576,271 Y21C probably damaging Het
Pla2g12b G A 10: 59,421,441 probably benign Het
Ralgapb T C 2: 158,456,572 V907A probably damaging Het
Rnls A T 19: 33,138,200 D157E probably damaging Het
Slc7a14 C A 3: 31,237,548 V194L probably benign Het
Slc7a7 G A 14: 54,379,058 T189I probably damaging Het
Snupn C A 9: 56,982,824 Q310K possibly damaging Het
Ssh1 A G 5: 113,942,631 Y891H probably benign Het
Suclg2 T C 6: 95,569,721 D258G probably damaging Het
Ubr3 A G 2: 69,973,329 I1088V probably benign Het
Vmn1r3 A G 4: 3,185,031 I92T probably damaging Het
Vmn2r69 G A 7: 85,411,449 S309F probably damaging Het
Wsb1 A T 11: 79,241,618 H325Q probably damaging Het
Zfp263 A G 16: 3,748,217 S281G probably benign Het
Zfp507 A G 7: 35,794,188 S477P probably damaging Het
Other mutations in Tpk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0084:Tpk1 UTSW 6 43346829 missense possibly damaging 0.94
R1736:Tpk1 UTSW 6 43611350 missense probably benign 0.09
R2348:Tpk1 UTSW 6 43346844 missense probably damaging 0.97
R4664:Tpk1 UTSW 6 43611335 missense probably benign 0.08
R4804:Tpk1 UTSW 6 43593078 intron probably benign
R5172:Tpk1 UTSW 6 43560017 splice site probably null
R5230:Tpk1 UTSW 6 43423719 missense probably damaging 1.00
R5485:Tpk1 UTSW 6 43665812 utr 5 prime probably benign
R6126:Tpk1 UTSW 6 43423660 missense probably damaging 1.00
R6326:Tpk1 UTSW 6 43346802 missense possibly damaging 0.77
R6460:Tpk1 UTSW 6 43469027 missense probably benign 0.01
R6767:Tpk1 UTSW 6 43346793 missense possibly damaging 0.93
R8061:Tpk1 UTSW 6 43346844 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCAGAGGCTCATATTTTCACATC -3'
(R):5'- TGGCCCTGGACATATTTATCC -3'

Sequencing Primer
(F):5'- TTCACATCATTTCTGCCCAAAAC -3'
(R):5'- CCTGGACATATTTATCCAATTTTTCG -3'
Posted On2017-10-10