Mutagenetix > Incidental Mutations

Incidental Mutation 'R0525:Arid5b'

48855

Institutional Source

Beutler Lab

Gene Symbol

Arid5b

Ensembl Gene

ENSMUSG00000019947

Gene Name

AT rich interactive domain 5B (MRF1-like)

Synonyms

5430435G07Rik, Mrf2beta, Mrf2alpha, Mrf2, Desrt

MMRRC Submission

038718-MU

Accession Numbers

Genbank: NM_023598; MGI: 2175912

Is this an essential gene?

Probably essential (E-score: 0.937) question?

Stock #

R0525 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

68092520-68278740 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 68097846 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 742 (D742G)

Ref Sequence

ENSEMBL: ENSMUSP00000151227 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020106] [ENSMUST00000218532] [ENSMUST00000219238]

AlphaFold

Q8BM75

Predicted Effect

probably benign
Transcript: ENSMUST00000020106

SMART Domains

Protein: ENSMUSP00000020106
Gene: ENSMUSG00000019947

Domain	Start	End	E-Value	Type
ARID	316	407	8.29e-35	SMART
BRIGHT	320	412	4.18e-38	SMART
low complexity region	425	438	N/A	INTRINSIC
low complexity region	451	462	N/A	INTRINSIC
low complexity region	538	549	N/A	INTRINSIC
low complexity region	695	718	N/A	INTRINSIC
low complexity region	730	741	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000218532
AA Change: D499G

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000219238
AA Change: D742G

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)

Meta Mutation Damage Score

0.1056

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.8%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interaction domain (ARID) family of DNA binding proteins. The encoded protein forms a histone H3K9Me2 demethylase complex with PHD finger protein 2 and regulates the transcription of target genes involved in adipogenesis and liver development. This gene also plays a role in cell growth and differentiation of B-lymphocyte progenitors, and single nucleotide polymorphisms in this gene are associated with acute lymphoblastic leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene experience a high level of mortality perinatally or earlier. Growth rates are low and mice remain small throughout live. There are abnormalities in various organ systems as well as the reproductive system. Fertility is reduced. [provided by MGI curators]

Allele List at MGI

All alleles(212) : Targeted, knock-out(2) Gene trapped(210)

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933440M02Rik	T	A	7: 125,331,499		noncoding transcript	Het
A930002H24Rik	A	G	17: 63,863,647	W49R	unknown	Het
Abca13	G	A	11: 9,293,371	V1745M	probably damaging	Het
Abca16	T	G	7: 120,465,810	Y563*	probably null	Het
Acot12	C	T	13: 91,760,067		probably benign	Het
Alms1	G	A	6: 85,587,760	A39T	unknown	Het
Atp1a4	G	A	1: 172,239,688		probably benign	Het
AU021092	T	A	16: 5,217,861	E145V	possibly damaging	Het
Calr4	A	T	4: 109,242,264		probably benign	Het
Clip4	T	A	17: 71,799,098		probably null	Het
Cnpy4	A	T	5: 138,192,616	H180L	probably benign	Het
Cyp2j9	T	C	4: 96,579,565		probably null	Het
Dgkq	A	G	5: 108,654,615	S406P	probably damaging	Het
Dhx8	G	A	11: 101,763,928	C1014Y	probably damaging	Het
Dnah3	T	C	7: 119,928,754	Y3824C	probably damaging	Het
Donson	A	T	16: 91,686,245	H69Q	probably damaging	Het
Dppa3	A	G	6: 122,629,980	E143G	probably damaging	Het
Drg1	A	G	11: 3,262,545	F96L	probably damaging	Het
Dvl1	A	C	4: 155,855,595	T395P	probably damaging	Het
Eftud2	A	T	11: 102,839,253	V897D	probably damaging	Het
Enpp6	A	G	8: 47,082,443	N341S	possibly damaging	Het
F11	A	G	8: 45,253,049	F100L	probably benign	Het
Fas	T	C	19: 34,319,327	Y189H	probably damaging	Het
Galnt14	G	T	17: 73,545,081	S114R	probably damaging	Het
Gfpt2	A	G	11: 49,829,775	I528V	probably benign	Het
Glt6d1	A	G	2: 25,794,268	V242A	possibly damaging	Het
Grm1	A	T	10: 10,719,209		probably benign	Het
Gskip	G	A	12: 105,698,965	A88T	probably damaging	Het
Gtpbp1	A	G	15: 79,713,447	I348V	probably benign	Het
Hnrnpul1	C	A	7: 25,740,883	R316L	possibly damaging	Het
Il34	T	C	8: 110,748,283	E121G	probably damaging	Het
Lrr1	T	C	12: 69,168,911	L19P	probably damaging	Het
Mat2b	A	G	11: 40,682,669		probably benign	Het
Mettl21e	T	C	1: 44,206,382	K235E	probably damaging	Het
Mir124-2hg	T	A	3: 17,785,529	E126V	possibly damaging	Het
Myh15	A	G	16: 49,132,051	K828R	probably benign	Het
Myom3	A	G	4: 135,764,926	D127G	possibly damaging	Het
Nek5	C	A	8: 22,079,077		probably benign	Het
Nudt7	A	T	8: 114,151,652		probably null	Het
Olfr1056	C	T	2: 86,356,275	V36I	probably benign	Het
Olfr1118	A	T	2: 87,309,349	T187S	probably benign	Het
Olfr1200	G	A	2: 88,767,314	Q334*	probably null	Het
Olfr350	T	C	2: 36,850,190	L48P	probably damaging	Het
Olfr961	T	G	9: 39,647,471	C248W	probably damaging	Het
Phyhd1	A	G	2: 30,281,028	H241R	probably damaging	Het
Pmch	T	C	10: 88,091,400		probably benign	Het
Ror1	A	G	4: 100,441,520	S697G	probably damaging	Het
Rslcan18	A	G	13: 67,112,258	V25A	probably benign	Het
Sema6b	T	C	17: 56,126,630	H426R	probably damaging	Het
Serpina3g	T	C	12: 104,238,339	F9S	probably damaging	Het
Serpinb12	T	A	1: 106,946,702	H52Q	probably benign	Het
Sh3gl1	T	C	17: 56,017,873	K294R	probably benign	Het
Sidt1	G	T	16: 44,259,446	T615K	possibly damaging	Het
Slc16a4	A	C	3: 107,297,939		probably benign	Het
Sned1	T	A	1: 93,271,974		probably null	Het
Sp2	A	T	11: 96,956,098		probably benign	Het
Steap1	T	A	5: 5,742,903	I3F	possibly damaging	Het
Stxbp5l	A	T	16: 37,129,797		probably null	Het
Tbc1d9	G	T	8: 83,268,985	V968F	probably benign	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Triobp	T	C	15: 78,973,898	L1233P	possibly damaging	Het
Trp53bp1	C	A	2: 121,251,868	A317S	probably null	Het
Trpc4ap	A	G	2: 155,640,478	F531L	possibly damaging	Het
Ugt1a10	C	T	1: 88,218,249	P473L	probably damaging	Het
Vmn1r86	T	C	7: 13,102,161	K213E	probably benign	Het
Vps8	G	A	16: 21,540,109		probably null	Het
Wnk1	A	T	6: 119,926,564	S2563T	probably damaging	Het
Yrdc	C	G	4: 124,851,766	R3G	probably damaging	Het
Zfp287	A	T	11: 62,715,244	V279E	probably benign	Het

Other mutations in Arid5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Arid5b	APN	10	68128975	missense	probably damaging	0.96
IGL01731:Arid5b	APN	10	68097609	missense	probably damaging	1.00
IGL02069:Arid5b	APN	10	68097399	missense	probably damaging	1.00
IGL02161:Arid5b	APN	10	68096668	missense	probably benign	0.00
IGL02555:Arid5b	APN	10	68101904	missense	probably benign	0.01
IGL02873:Arid5b	APN	10	68101950	missense	probably benign	0.06
IGL03119:Arid5b	APN	10	68243227	missense	probably damaging	1.00
IGL03271:Arid5b	APN	10	68097457	missense	possibly damaging	0.73
gobi	UTSW	10	68118345	missense	possibly damaging	0.92
3-1:Arid5b	UTSW	10	68098589	missense	probably damaging	1.00
PIT4677001:Arid5b	UTSW	10	68098011	missense	probably damaging	0.99
R0108:Arid5b	UTSW	10	68278729	utr 5 prime	probably benign
R0533:Arid5b	UTSW	10	68186033	missense	probably damaging	1.00
R0646:Arid5b	UTSW	10	68096977	missense	probably damaging	1.00
R1066:Arid5b	UTSW	10	68098356	missense	probably benign	0.04
R1487:Arid5b	UTSW	10	68097214	nonsense	probably null
R1638:Arid5b	UTSW	10	68277947	missense	possibly damaging	0.48
R1789:Arid5b	UTSW	10	68186067	missense	probably damaging	0.99
R2031:Arid5b	UTSW	10	68278688	critical splice donor site	probably null
R2337:Arid5b	UTSW	10	68097777	missense	possibly damaging	0.63
R2996:Arid5b	UTSW	10	68098462	missense	probably benign	0.01
R2997:Arid5b	UTSW	10	68098462	missense	probably benign	0.01
R3547:Arid5b	UTSW	10	68098462	missense	probably benign	0.01
R4411:Arid5b	UTSW	10	68096689	missense	probably damaging	1.00
R4860:Arid5b	UTSW	10	68243095	missense	probably damaging	0.97
R4860:Arid5b	UTSW	10	68243095	missense	probably damaging	0.97
R5219:Arid5b	UTSW	10	68278110	missense	probably benign	0.08
R5341:Arid5b	UTSW	10	68278127	missense	possibly damaging	0.87
R5434:Arid5b	UTSW	10	68096889	missense	possibly damaging	0.67
R5757:Arid5b	UTSW	10	68102079	missense	probably damaging	1.00
R6114:Arid5b	UTSW	10	68097744	missense	possibly damaging	0.89
R6313:Arid5b	UTSW	10	68097582	missense	possibly damaging	0.95
R6338:Arid5b	UTSW	10	68098561	nonsense	probably null
R6525:Arid5b	UTSW	10	68097666	missense	possibly damaging	0.47
R6915:Arid5b	UTSW	10	68186212	nonsense	probably null
R7013:Arid5b	UTSW	10	68097819	missense	probably damaging	1.00
R7099:Arid5b	UTSW	10	68098179	missense	probably damaging	1.00
R7260:Arid5b	UTSW	10	68097807	missense	probably damaging	1.00
R7324:Arid5b	UTSW	10	68128922	missense	probably benign	0.44
R7334:Arid5b	UTSW	10	68243177	missense	possibly damaging	0.61
R7432:Arid5b	UTSW	10	68118266	missense	probably damaging	1.00
R7453:Arid5b	UTSW	10	68243164	missense	probably benign	0.01
R7649:Arid5b	UTSW	10	68118345	missense	possibly damaging	0.92
R7659:Arid5b	UTSW	10	68098587	missense	probably benign
R7661:Arid5b	UTSW	10	68098587	missense	probably benign
R7662:Arid5b	UTSW	10	68098587	missense	probably benign
R7663:Arid5b	UTSW	10	68098587	missense	probably benign
R7665:Arid5b	UTSW	10	68098587	missense	probably benign
R7666:Arid5b	UTSW	10	68098587	missense	probably benign
R7759:Arid5b	UTSW	10	68097802	missense	probably damaging	1.00
R7779:Arid5b	UTSW	10	68096776	missense	probably damaging	1.00
R7788:Arid5b	UTSW	10	68098587	missense	probably benign
R7789:Arid5b	UTSW	10	68098587	missense	probably benign
R7875:Arid5b	UTSW	10	68128941	missense	probably benign	0.02
R8079:Arid5b	UTSW	10	68098356	missense	possibly damaging	0.88
R8096:Arid5b	UTSW	10	68186152	missense	probably benign	0.00
R8228:Arid5b	UTSW	10	68278706	missense	possibly damaging	0.95
R8377:Arid5b	UTSW	10	68097387	missense	probably damaging	0.96
R8757:Arid5b	UTSW	10	68097810	missense	probably damaging	1.00
R8910:Arid5b	UTSW	10	68098278	missense
R8954:Arid5b	UTSW	10	68101980	missense	possibly damaging	0.88
R9234:Arid5b	UTSW	10	68128798	missense	possibly damaging	0.82
R9272:Arid5b	UTSW	10	68102052	missense	probably damaging	0.99
R9430:Arid5b	UTSW	10	68186257	critical splice acceptor site	probably null
X0066:Arid5b	UTSW	10	68118302	missense	probably damaging	1.00
Z1177:Arid5b	UTSW	10	68097228	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGGGAGACGGCTCTCTTCTCTAAC -3'
(R):5'- CAACTACATTGCCAACTGCACTGTG -3'

Sequencing Primer
(F):5'- TGAGGATGTAGGAGTCTGCCAG -3'
(R):5'- AAGGTCCTTGTGGTCCAATC -3'

Posted On

2013-06-12