Incidental Mutation 'R6141:Slc4a10'
ID488561
Institutional Source Beutler Lab
Gene Symbol Slc4a10
Ensembl Gene ENSMUSG00000026904
Gene Namesolute carrier family 4, sodium bicarbonate cotransporter-like, member 10
SynonymsNCBE
MMRRC Submission 044288-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6141 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location62046462-62326730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62211445 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 123 (E123G)
Ref Sequence ENSEMBL: ENSMUSP00000108099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054484] [ENSMUST00000102735] [ENSMUST00000112480]
Predicted Effect probably damaging
Transcript: ENSMUST00000054484
AA Change: E123G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061411
Gene: ENSMUSG00000026904
AA Change: E123G

DomainStartEndE-ValueType
low complexity region 57 79 N/A INTRINSIC
low complexity region 106 111 N/A INTRINSIC
Pfam:Band_3_cyto 146 405 9e-107 PFAM
Pfam:HCO3_cotransp 445 959 1e-246 PFAM
transmembrane domain 967 989 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102735
AA Change: E123G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099796
Gene: ENSMUSG00000026904
AA Change: E123G

DomainStartEndE-ValueType
low complexity region 57 79 N/A INTRINSIC
low complexity region 106 111 N/A INTRINSIC
Pfam:Band_3_cyto 146 405 2e-106 PFAM
Pfam:HCO3_cotransp 445 959 2.4e-246 PFAM
transmembrane domain 967 989 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112480
AA Change: E123G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108099
Gene: ENSMUSG00000026904
AA Change: E123G

DomainStartEndE-ValueType
low complexity region 57 79 N/A INTRINSIC
low complexity region 106 111 N/A INTRINSIC
Pfam:Band_3_cyto 146 435 9.6e-108 PFAM
Pfam:HCO3_cotransp 476 989 1.5e-245 PFAM
transmembrane domain 997 1019 N/A INTRINSIC
low complexity region 1041 1055 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155219
Meta Mutation Damage Score 0.7156 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a small family of sodium-coupled bicarbonate transporters (NCBTs) that regulate the intracellular pH of neurons, the secretion of bicarbonate ions across the choroid plexus, and the pH of the brain extracellular fluid. The protein encoded by this gene was initially identified as a sodium-driven chloride bicarbonate exchanger (NCBE) though there is now evidence that its sodium/bicarbonate cotransport activity is independent of any chloride ion countertransport under physiological conditions. This gene is now classified as a member A10 of the SLC4 family of transmembrane solute carriers. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice with homozygous disruption of this gene exhibit reduced brain ventricle volume, reduced neuronal excitability, impaired pH regulation of neurons, and increased threshold to induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik A T 7: 42,448,059 C4S probably damaging Het
Abhd5 A T 9: 122,377,933 T95S probably benign Het
Ambra1 A T 2: 91,875,754 N795Y probably damaging Het
Brca2 A G 5: 150,540,637 N1289D possibly damaging Het
Cavin2 T C 1: 51,300,938 L258P probably damaging Het
Ccdc110 A G 8: 45,941,770 T233A possibly damaging Het
Ccdc14 T A 16: 34,706,562 I279N probably damaging Het
Cntn5 A T 9: 10,144,157 L169Q probably benign Het
Dbf4 T C 5: 8,408,545 S157G possibly damaging Het
Defb22 A T 2: 152,485,802 N154K unknown Het
Eepd1 T A 9: 25,482,984 D181E probably benign Het
Etfa T C 9: 55,464,819 H286R probably damaging Het
Gm44419 T A 6: 65,150,956 noncoding transcript Het
Gpatch4 C T 3: 88,054,740 R155* probably null Het
Grik1 T G 16: 87,896,872 R862S probably benign Het
Hectd1 A C 12: 51,746,092 probably null Het
Ift122 T C 6: 115,916,011 W919R probably damaging Het
Iqgap2 A T 13: 95,721,686 probably null Het
Kcnq4 A T 4: 120,715,869 I245N probably damaging Het
Map3k3 G T 11: 106,097,048 R21L probably benign Het
Mllt10 T C 2: 18,210,793 V1063A probably damaging Het
Msr1 A T 8: 39,631,319 V65E probably damaging Het
Myom2 A T 8: 15,063,903 D17V probably damaging Het
Naaladl1 T A 19: 6,109,755 probably null Het
Naip6 T C 13: 100,308,233 Y239C possibly damaging Het
Nckap1 C A 2: 80,530,207 D533Y probably damaging Het
Ndufs2 T C 1: 171,236,616 E375G probably damaging Het
Nsd1 T C 13: 55,291,284 V1605A probably damaging Het
Olfr1290 A G 2: 111,490,119 I13T probably benign Het
Olfr1468-ps1 A T 19: 13,375,283 Y107F probably benign Het
Olfr199 T A 16: 59,216,553 H20L probably benign Het
Olfr629 C A 7: 103,740,787 R151L probably damaging Het
Olfr872 T A 9: 20,260,458 M206K probably benign Het
Pcp2 G A 8: 3,623,543 probably null Het
Pdgfra A G 5: 75,173,396 S377G probably damaging Het
Pqlc2 A G 4: 139,300,245 V262A probably benign Het
Reep5 A T 18: 34,372,458 Y53* probably null Het
Ric1 T C 19: 29,595,442 S761P probably damaging Het
Satb1 T C 17: 51,775,376 T417A possibly damaging Het
Slc1a7 T A 4: 108,002,182 M156K possibly damaging Het
Snupn C A 9: 56,982,824 Q310K possibly damaging Het
Stard13 A T 5: 151,042,242 V916E probably damaging Het
Tlr1 T C 5: 64,925,213 R674G possibly damaging Het
Tnfsf11 A G 14: 78,307,859 Y11H probably damaging Het
Tnr T A 1: 159,887,122 V857E probably benign Het
Tubgcp5 A G 7: 55,806,778 I373V probably benign Het
Ush2a A T 1: 188,357,963 R414S possibly damaging Het
Vmn2r100 T C 17: 19,522,314 S317P probably benign Het
Wdr49 A T 3: 75,323,682 F558I probably benign Het
Zfyve16 A G 13: 92,511,597 I983T probably benign Het
Other mutations in Slc4a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Slc4a10 APN 2 62290001 missense probably damaging 1.00
IGL00990:Slc4a10 APN 2 62286940 missense probably damaging 1.00
IGL01294:Slc4a10 APN 2 62253309 critical splice acceptor site probably null
IGL01628:Slc4a10 APN 2 62268666 missense probably damaging 1.00
IGL01773:Slc4a10 APN 2 62190757 missense probably damaging 0.97
IGL02119:Slc4a10 APN 2 62228670 missense probably damaging 1.00
IGL02125:Slc4a10 APN 2 62268171 missense probably benign 0.02
IGL02406:Slc4a10 APN 2 62190769 missense probably benign 0.37
IGL02890:Slc4a10 APN 2 62286916 missense probably damaging 1.00
IGL02959:Slc4a10 APN 2 62268143 missense probably damaging 1.00
IGL02979:Slc4a10 APN 2 62288747 missense probably null 1.00
IGL03144:Slc4a10 APN 2 62250466 missense probably benign 0.00
IGL03175:Slc4a10 APN 2 62296960 missense probably damaging 0.99
IGL03383:Slc4a10 APN 2 62267436 missense probably damaging 1.00
IGL03412:Slc4a10 APN 2 62250543 splice site probably benign
R0085:Slc4a10 UTSW 2 62244346 splice site probably benign
R0401:Slc4a10 UTSW 2 62190848 missense probably benign 0.27
R0433:Slc4a10 UTSW 2 62289983 missense probably benign 0.01
R0482:Slc4a10 UTSW 2 62297017 splice site probably benign
R0506:Slc4a10 UTSW 2 62250533 missense probably benign 0.13
R0511:Slc4a10 UTSW 2 62286862 missense probably damaging 0.97
R0590:Slc4a10 UTSW 2 62190893 splice site probably benign
R0883:Slc4a10 UTSW 2 62243398 missense probably benign 0.11
R1167:Slc4a10 UTSW 2 62228574 missense probably damaging 1.00
R1276:Slc4a10 UTSW 2 62250443 missense probably damaging 0.99
R1395:Slc4a10 UTSW 2 62313286 missense probably benign 0.00
R1455:Slc4a10 UTSW 2 62286930 missense probably damaging 1.00
R1589:Slc4a10 UTSW 2 62257462 missense probably damaging 1.00
R1677:Slc4a10 UTSW 2 62324727 missense probably benign
R1848:Slc4a10 UTSW 2 62316606 missense probably damaging 1.00
R1987:Slc4a10 UTSW 2 62268204 missense probably damaging 1.00
R1988:Slc4a10 UTSW 2 62268204 missense probably damaging 1.00
R2018:Slc4a10 UTSW 2 62234381 missense probably damaging 1.00
R2019:Slc4a10 UTSW 2 62234381 missense probably damaging 1.00
R2407:Slc4a10 UTSW 2 62313343 missense probably benign
R4067:Slc4a10 UTSW 2 62046645 start codon destroyed probably benign 0.00
R4184:Slc4a10 UTSW 2 62317442 intron probably benign
R4255:Slc4a10 UTSW 2 62281936 missense probably benign 0.10
R4282:Slc4a10 UTSW 2 62244343 splice site probably null
R4296:Slc4a10 UTSW 2 62234428 missense possibly damaging 0.80
R4361:Slc4a10 UTSW 2 62243385 missense probably benign 0.00
R4596:Slc4a10 UTSW 2 62296858 missense probably damaging 1.00
R4709:Slc4a10 UTSW 2 62257517 missense probably null 1.00
R4755:Slc4a10 UTSW 2 62296988 missense probably damaging 1.00
R4836:Slc4a10 UTSW 2 62268187 missense probably damaging 1.00
R4841:Slc4a10 UTSW 2 62257595 missense possibly damaging 0.68
R4998:Slc4a10 UTSW 2 62244439 missense probably benign 0.00
R5069:Slc4a10 UTSW 2 62267571 missense probably benign 0.06
R5223:Slc4a10 UTSW 2 62253366 missense probably damaging 1.00
R5244:Slc4a10 UTSW 2 62288725 missense probably damaging 1.00
R5386:Slc4a10 UTSW 2 62290058 missense probably damaging 1.00
R5808:Slc4a10 UTSW 2 62250472 missense probably damaging 1.00
R5999:Slc4a10 UTSW 2 62243431 missense probably benign 0.10
R6007:Slc4a10 UTSW 2 62268872 missense probably benign 0.44
R6009:Slc4a10 UTSW 2 62046690 missense probably benign 0.00
R6015:Slc4a10 UTSW 2 62228702 missense probably benign 0.05
R6103:Slc4a10 UTSW 2 62234465 missense probably damaging 1.00
R6193:Slc4a10 UTSW 2 62243357 splice site probably null
R6217:Slc4a10 UTSW 2 62303951 missense probably benign 0.27
R6280:Slc4a10 UTSW 2 62281966 missense probably benign 0.05
R6523:Slc4a10 UTSW 2 62286961 nonsense probably null
R6643:Slc4a10 UTSW 2 62228710 missense possibly damaging 0.96
R6660:Slc4a10 UTSW 2 62250403 missense possibly damaging 0.55
R7008:Slc4a10 UTSW 2 62286922 missense probably benign 0.00
R7083:Slc4a10 UTSW 2 62234495 missense probably benign 0.03
R7223:Slc4a10 UTSW 2 62268665 missense probably damaging 0.99
R7243:Slc4a10 UTSW 2 62303862 missense probably damaging 1.00
R7449:Slc4a10 UTSW 2 62303946 missense probably benign
R7621:Slc4a10 UTSW 2 62250479 missense probably damaging 0.98
R7692:Slc4a10 UTSW 2 62303964 missense possibly damaging 0.94
R7742:Slc4a10 UTSW 2 62296850 missense probably damaging 1.00
R7905:Slc4a10 UTSW 2 62268151 missense probably damaging 1.00
R7988:Slc4a10 UTSW 2 62268151 missense probably damaging 1.00
U24488:Slc4a10 UTSW 2 62046658 missense probably benign 0.05
X0019:Slc4a10 UTSW 2 62228599 missense probably damaging 1.00
Z1088:Slc4a10 UTSW 2 62228571 missense probably damaging 1.00
Z1176:Slc4a10 UTSW 2 62211379 missense probably damaging 1.00
Z1176:Slc4a10 UTSW 2 62244416 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGAATGCTCAGGTGAAGAATAC -3'
(R):5'- ACCATTACAGGATCTGCCCAG -3'

Sequencing Primer
(F):5'- TACAAGGAGTGTGAGGTTGGC -3'
(R):5'- ATCTGCCCAGGCCAGATGAG -3'
Posted On2017-10-10