Incidental Mutation 'R6141:Nckap1'
ID488562
Institutional Source Beutler Lab
Gene Symbol Nckap1
Ensembl Gene ENSMUSG00000027002
Gene NameNCK-associated protein 1
Synonymsmh19, Hem-2, Nap1, Hem2, H19
MMRRC Submission 044288-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6141 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location80500512-80581380 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 80530207 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 533 (D533Y)
Ref Sequence ENSEMBL: ENSMUSP00000107390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028386] [ENSMUST00000111760]
Predicted Effect probably damaging
Transcript: ENSMUST00000028386
AA Change: D527Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028386
Gene: ENSMUSG00000027002
AA Change: D527Y

DomainStartEndE-ValueType
Pfam:Nckap1 8 1124 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111760
AA Change: D533Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107390
Gene: ENSMUSG00000027002
AA Change: D533Y

DomainStartEndE-ValueType
Pfam:Nckap1 9 1128 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154793
Meta Mutation Damage Score 0.9577 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene exhibit growth arrest at midgestation, an open neural tube, cardia bifida, defective foregut development, defects in endoderm and mesoderm migration and sometimes duplication of the anteroposterior body axis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik A T 7: 42,448,059 C4S probably damaging Het
Abhd5 A T 9: 122,377,933 T95S probably benign Het
Ambra1 A T 2: 91,875,754 N795Y probably damaging Het
Brca2 A G 5: 150,540,637 N1289D possibly damaging Het
Cavin2 T C 1: 51,300,938 L258P probably damaging Het
Ccdc110 A G 8: 45,941,770 T233A possibly damaging Het
Ccdc14 T A 16: 34,706,562 I279N probably damaging Het
Cntn5 A T 9: 10,144,157 L169Q probably benign Het
Dbf4 T C 5: 8,408,545 S157G possibly damaging Het
Defb22 A T 2: 152,485,802 N154K unknown Het
Eepd1 T A 9: 25,482,984 D181E probably benign Het
Etfa T C 9: 55,464,819 H286R probably damaging Het
Gm44419 T A 6: 65,150,956 noncoding transcript Het
Gpatch4 C T 3: 88,054,740 R155* probably null Het
Grik1 T G 16: 87,896,872 R862S probably benign Het
Hectd1 A C 12: 51,746,092 probably null Het
Ift122 T C 6: 115,916,011 W919R probably damaging Het
Iqgap2 A T 13: 95,721,686 probably null Het
Kcnq4 A T 4: 120,715,869 I245N probably damaging Het
Map3k3 G T 11: 106,097,048 R21L probably benign Het
Mllt10 T C 2: 18,210,793 V1063A probably damaging Het
Msr1 A T 8: 39,631,319 V65E probably damaging Het
Myom2 A T 8: 15,063,903 D17V probably damaging Het
Naaladl1 T A 19: 6,109,755 probably null Het
Naip6 T C 13: 100,308,233 Y239C possibly damaging Het
Ndufs2 T C 1: 171,236,616 E375G probably damaging Het
Nsd1 T C 13: 55,291,284 V1605A probably damaging Het
Olfr1290 A G 2: 111,490,119 I13T probably benign Het
Olfr1468-ps1 A T 19: 13,375,283 Y107F probably benign Het
Olfr199 T A 16: 59,216,553 H20L probably benign Het
Olfr629 C A 7: 103,740,787 R151L probably damaging Het
Olfr872 T A 9: 20,260,458 M206K probably benign Het
Pcp2 G A 8: 3,623,543 probably null Het
Pdgfra A G 5: 75,173,396 S377G probably damaging Het
Pqlc2 A G 4: 139,300,245 V262A probably benign Het
Reep5 A T 18: 34,372,458 Y53* probably null Het
Ric1 T C 19: 29,595,442 S761P probably damaging Het
Satb1 T C 17: 51,775,376 T417A possibly damaging Het
Slc1a7 T A 4: 108,002,182 M156K possibly damaging Het
Slc4a10 A G 2: 62,211,445 E123G probably damaging Het
Snupn C A 9: 56,982,824 Q310K possibly damaging Het
Stard13 A T 5: 151,042,242 V916E probably damaging Het
Tlr1 T C 5: 64,925,213 R674G possibly damaging Het
Tnfsf11 A G 14: 78,307,859 Y11H probably damaging Het
Tnr T A 1: 159,887,122 V857E probably benign Het
Tubgcp5 A G 7: 55,806,778 I373V probably benign Het
Ush2a A T 1: 188,357,963 R414S possibly damaging Het
Vmn2r100 T C 17: 19,522,314 S317P probably benign Het
Wdr49 A T 3: 75,323,682 F558I probably benign Het
Zfyve16 A G 13: 92,511,597 I983T probably benign Het
Other mutations in Nckap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Nckap1 APN 2 80506202 missense possibly damaging 0.87
IGL00896:Nckap1 APN 2 80580953 missense possibly damaging 0.59
IGL01343:Nckap1 APN 2 80519842 missense possibly damaging 0.81
IGL01593:Nckap1 APN 2 80520570 missense probably benign 0.06
IGL01677:Nckap1 APN 2 80530297 missense probably benign 0.04
IGL01873:Nckap1 APN 2 80553385 missense possibly damaging 0.95
IGL01874:Nckap1 APN 2 80525636 missense probably damaging 1.00
IGL01947:Nckap1 APN 2 80508753 missense probably damaging 1.00
IGL02268:Nckap1 APN 2 80528618 missense probably benign 0.16
IGL02348:Nckap1 APN 2 80517982 missense probably damaging 1.00
IGL03349:Nckap1 APN 2 80525560 missense probably benign 0.07
PIT4151001:Nckap1 UTSW 2 80520370 critical splice donor site probably null
R0326:Nckap1 UTSW 2 80553370 missense probably benign 0.41
R0345:Nckap1 UTSW 2 80544977 splice site probably benign
R0520:Nckap1 UTSW 2 80541530 splice site probably benign
R0603:Nckap1 UTSW 2 80512729 missense probably benign 0.19
R0924:Nckap1 UTSW 2 80554249 missense probably benign 0.34
R0930:Nckap1 UTSW 2 80554249 missense probably benign 0.34
R0964:Nckap1 UTSW 2 80547899 critical splice donor site probably null
R1122:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1123:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1124:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1125:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1127:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1182:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1234:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1236:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1384:Nckap1 UTSW 2 80533670 missense possibly damaging 0.90
R1402:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1402:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1511:Nckap1 UTSW 2 80553415 missense probably damaging 0.99
R1677:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1686:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1687:Nckap1 UTSW 2 80520585 missense probably damaging 0.96
R1717:Nckap1 UTSW 2 80512670 splice site probably benign
R1789:Nckap1 UTSW 2 80520556 missense probably benign 0.44
R1822:Nckap1 UTSW 2 80517898 missense possibly damaging 0.58
R1840:Nckap1 UTSW 2 80502250 missense possibly damaging 0.88
R1926:Nckap1 UTSW 2 80506838 missense probably damaging 1.00
R1968:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1970:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R2027:Nckap1 UTSW 2 80535518 missense probably damaging 1.00
R2063:Nckap1 UTSW 2 80570150 missense probably damaging 1.00
R2504:Nckap1 UTSW 2 80530218 missense probably benign 0.40
R3824:Nckap1 UTSW 2 80540560 missense possibly damaging 0.72
R4784:Nckap1 UTSW 2 80506934 missense probably benign 0.15
R4908:Nckap1 UTSW 2 80523374 critical splice donor site probably null
R5077:Nckap1 UTSW 2 80548933 missense probably damaging 0.99
R5311:Nckap1 UTSW 2 80540122 missense probably damaging 1.00
R5439:Nckap1 UTSW 2 80512690 missense possibly damaging 0.81
R6209:Nckap1 UTSW 2 80525602 missense probably damaging 1.00
R6226:Nckap1 UTSW 2 80508781 missense possibly damaging 0.96
R6294:Nckap1 UTSW 2 80541514 missense probably benign 0.03
R6458:Nckap1 UTSW 2 80512549 intron probably null
R6937:Nckap1 UTSW 2 80508716 missense probably damaging 1.00
R6986:Nckap1 UTSW 2 80520567 missense probably benign 0.03
R7180:Nckap1 UTSW 2 80506892 missense probably benign 0.01
R7208:Nckap1 UTSW 2 80540198 missense probably benign 0.24
R7363:Nckap1 UTSW 2 80540168 missense probably damaging 1.00
R7448:Nckap1 UTSW 2 80524541 missense probably damaging 1.00
R7513:Nckap1 UTSW 2 80502291 missense possibly damaging 0.81
R7806:Nckap1 UTSW 2 80541499 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAGGCATGGTTACCAGCTATC -3'
(R):5'- TCCTCTGTACAAAGACAAGCG -3'

Sequencing Primer
(F):5'- GGCTGTCCTAGAACTCAGTAGAC -3'
(R):5'- CAAGCGTTGAGTCATTAGCAGTTCC -3'
Posted On2017-10-10