Mutagenetix > Incidental Mutation

Incidental Mutation 'R6141:Ift122'

488576

Institutional Source

Beutler Lab

Gene Symbol

Ift122

Ensembl Gene

ENSMUSG00000030323

Gene Name

intraflagellar transport 122

Synonyms

C86139, sopb, Wdr10

MMRRC Submission

044288-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6141 (G1)

Quality Score

101.008

Status

Validated

Chromosome

Chromosomal Location

115853470-115926699 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 115916011 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 919 (W919R)

Ref Sequence

ENSEMBL: ENSMUSP00000108545 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038234] [ENSMUST00000112923] [ENSMUST00000112925] [ENSMUST00000141305]

AlphaFold

Q6NWV3

Predicted Effect

probably damaging
Transcript: ENSMUST00000038234
AA Change: W860R

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000045468
Gene: ENSMUSG00000030323
AA Change: W860R

Domain	Start	End	E-Value	Type
WD40	1	39	7.1e1	SMART
WD40	42	81	7.16e-10	SMART
WD40	83	120	1.54e0	SMART
WD40	122	160	1.43e0	SMART
WD40	162	208	2.29e1	SMART
WD40	210	249	1.91e1	SMART
WD40	251	290	3.45e-3	SMART
WD40	448	483	1.43e1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112923
AA Change: W919R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108545
Gene: ENSMUSG00000030323
AA Change: W919R

Domain	Start	End	E-Value	Type
WD40	1	39	7.1e1	SMART
WD40	42	81	7.16e-10	SMART
WD40	83	120	1.54e0	SMART
WD40	122	160	1.43e0	SMART
Blast:WD40	163	267	3e-46	BLAST
WD40	269	308	1.91e1	SMART
WD40	310	349	3.45e-3	SMART
WD40	507	542	1.43e1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112925
AA Change: W860R

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000108547
Gene: ENSMUSG00000030323
AA Change: W860R

Domain	Start	End	E-Value	Type
WD40	1	39	7.1e1	SMART
WD40	42	81	7.16e-10	SMART
WD40	83	120	1.54e0	SMART
WD40	122	160	1.43e0	SMART
WD40	162	208	2.29e1	SMART
WD40	210	249	1.91e1	SMART
WD40	251	290	3.45e-3	SMART
WD40	448	483	1.43e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124283

Predicted Effect

probably benign
Transcript: ENSMUST00000141305

SMART Domains

Protein: ENSMUSP00000138535
Gene: ENSMUSG00000030323

Domain	Start	End	E-Value	Type
WD40	1	39	7.1e1	SMART
WD40	42	81	7.16e-10	SMART
WD40	83	120	1.54e0	SMART
low complexity region	124	134	N/A	INTRINSIC
low complexity region	162	176	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155565

Meta Mutation Damage Score

0.6625

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This cytoplasmic protein contains seven WD repeats and an AF-2 domain which function by recruiting coregulatory molecules and in transcriptional activation. Mutations in this gene cause cranioectodermal dysplasia-1. A related pseudogene is located on chromosome 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for a null mutation display embryonic lethality during organogenesis with exencephaly, a ventralized caudal neural tube, preaxial polydactyly, abnormal cilia, and left-right patterning defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933421I07Rik	A	T	7: 42,448,059	C4S	probably damaging	Het
Abhd5	A	T	9: 122,377,933	T95S	probably benign	Het
Ambra1	A	T	2: 91,875,754	N795Y	probably damaging	Het
Brca2	A	G	5: 150,540,637	N1289D	possibly damaging	Het
Cavin2	T	C	1: 51,300,938	L258P	probably damaging	Het
Ccdc110	A	G	8: 45,941,770	T233A	possibly damaging	Het
Ccdc14	T	A	16: 34,706,562	I279N	probably damaging	Het
Cntn5	A	T	9: 10,144,157	L169Q	probably benign	Het
Dbf4	T	C	5: 8,408,545	S157G	possibly damaging	Het
Defb22	A	T	2: 152,485,802	N154K	unknown	Het
Eepd1	T	A	9: 25,482,984	D181E	probably benign	Het
Etfa	T	C	9: 55,464,819	H286R	probably damaging	Het
Gm44419	T	A	6: 65,150,956		noncoding transcript	Het
Gpatch4	C	T	3: 88,054,740	R155*	probably null	Het
Grik1	T	G	16: 87,896,872	R862S	probably benign	Het
Hectd1	A	C	12: 51,746,092		probably null	Het
Iqgap2	A	T	13: 95,721,686		probably null	Het
Kcnq4	A	T	4: 120,715,869	I245N	probably damaging	Het
Map3k3	G	T	11: 106,097,048	R21L	probably benign	Het
Mllt10	T	C	2: 18,210,793	V1063A	probably damaging	Het
Msr1	A	T	8: 39,631,319	V65E	probably damaging	Het
Myom2	A	T	8: 15,063,903	D17V	probably damaging	Het
Naaladl1	T	A	19: 6,109,755		probably null	Het
Naip6	T	C	13: 100,308,233	Y239C	possibly damaging	Het
Nckap1	C	A	2: 80,530,207	D533Y	probably damaging	Het
Ndufs2	T	C	1: 171,236,616	E375G	probably damaging	Het
Nsd1	T	C	13: 55,291,284	V1605A	probably damaging	Het
Olfr1290	A	G	2: 111,490,119	I13T	probably benign	Het
Olfr1468-ps1	A	T	19: 13,375,283	Y107F	probably benign	Het
Olfr199	T	A	16: 59,216,553	H20L	probably benign	Het
Olfr629	C	A	7: 103,740,787	R151L	probably damaging	Het
Olfr872	T	A	9: 20,260,458	M206K	probably benign	Het
Pcp2	G	A	8: 3,623,543		probably null	Het
Pdgfra	A	G	5: 75,173,396	S377G	probably damaging	Het
Pqlc2	A	G	4: 139,300,245	V262A	probably benign	Het
Reep5	A	T	18: 34,372,458	Y53*	probably null	Het
Ric1	T	C	19: 29,595,442	S761P	probably damaging	Het
Satb1	T	C	17: 51,775,376	T417A	possibly damaging	Het
Slc1a7	T	A	4: 108,002,182	M156K	possibly damaging	Het
Slc4a10	A	G	2: 62,211,445	E123G	probably damaging	Het
Snupn	C	A	9: 56,982,824	Q310K	possibly damaging	Het
Stard13	A	T	5: 151,042,242	V916E	probably damaging	Het
Tlr1	T	C	5: 64,925,213	R674G	possibly damaging	Het
Tnfsf11	A	G	14: 78,307,859	Y11H	probably damaging	Het
Tnr	T	A	1: 159,887,122	V857E	probably benign	Het
Tubgcp5	A	G	7: 55,806,778	I373V	probably benign	Het
Ush2a	A	T	1: 188,357,963	R414S	possibly damaging	Het
Vmn2r100	T	C	17: 19,522,314	S317P	probably benign	Het
Wdr49	A	T	3: 75,323,682	F558I	probably benign	Het
Zfyve16	A	G	13: 92,511,597	I983T	probably benign	Het

Other mutations in Ift122

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Ift122	APN	6	115917057	missense	probably benign	0.10
IGL00783:Ift122	APN	6	115905902	missense	probably benign
IGL00784:Ift122	APN	6	115905902	missense	probably benign
IGL00799:Ift122	APN	6	115877536	missense	probably damaging	1.00
IGL00908:Ift122	APN	6	115913909	missense	probably benign	0.00
IGL01012:Ift122	APN	6	115899491	missense	probably damaging	0.99
IGL01444:Ift122	APN	6	115884379	missense	probably benign	0.08
IGL01451:Ift122	APN	6	115912604	critical splice donor site	probably null
IGL01940:Ift122	APN	6	115887371	splice site	probably benign
IGL02089:Ift122	APN	6	115925437	missense	probably benign	0.00
IGL02331:Ift122	APN	6	115887324	missense	probably damaging	1.00
IGL02929:Ift122	APN	6	115902877	missense	probably damaging	1.00
IGL03169:Ift122	APN	6	115905961	splice site	probably benign
PIT1430001:Ift122	UTSW	6	115925744	splice site	probably benign
R0158:Ift122	UTSW	6	115924484	splice site	probably benign
R0496:Ift122	UTSW	6	115905902	missense	probably benign
R1065:Ift122	UTSW	6	115875325	splice site	probably null
R1670:Ift122	UTSW	6	115923883	missense	probably benign	0.05
R1861:Ift122	UTSW	6	115891928	missense	probably damaging	1.00
R1889:Ift122	UTSW	6	115894421	critical splice donor site	probably null
R1990:Ift122	UTSW	6	115924367	missense	probably damaging	1.00
R2362:Ift122	UTSW	6	115884350	missense	probably damaging	0.99
R2385:Ift122	UTSW	6	115912522	missense	probably benign	0.21
R3734:Ift122	UTSW	6	115925501	splice site	probably benign
R3800:Ift122	UTSW	6	115925906	missense	probably benign	0.03
R3981:Ift122	UTSW	6	115913921	missense	probably benign	0.02
R4289:Ift122	UTSW	6	115923891	missense	probably damaging	1.00
R4545:Ift122	UTSW	6	115890588	missense	probably damaging	1.00
R4546:Ift122	UTSW	6	115890588	missense	probably damaging	1.00
R4641:Ift122	UTSW	6	115888765	nonsense	probably null
R4815:Ift122	UTSW	6	115881556	missense	possibly damaging	0.95
R4854:Ift122	UTSW	6	115862746	missense	possibly damaging	0.61
R4928:Ift122	UTSW	6	115915858	utr 3 prime	probably benign
R5021:Ift122	UTSW	6	115864372	missense	probably benign	0.41
R5121:Ift122	UTSW	6	115912534	missense	probably benign	0.04
R5200:Ift122	UTSW	6	115920379	missense	probably damaging	0.99
R5549:Ift122	UTSW	6	115892022	missense	probably damaging	1.00
R6111:Ift122	UTSW	6	115875286	missense	probably damaging	1.00
R6766:Ift122	UTSW	6	115926243	missense	probably benign	0.15
R7379:Ift122	UTSW	6	115926302	missense	probably benign
R7402:Ift122	UTSW	6	115894322	missense	probably benign	0.00
R7436:Ift122	UTSW	6	115926302	missense	probably benign
R7437:Ift122	UTSW	6	115926302	missense	probably benign
R7438:Ift122	UTSW	6	115926302	missense	probably benign
R7517:Ift122	UTSW	6	115890582	missense	probably benign	0.37
R7978:Ift122	UTSW	6	115920352	missense	probably benign	0.37
R8492:Ift122	UTSW	6	115887005	missense	probably benign	0.02
R8493:Ift122	UTSW	6	115910331	missense	probably benign	0.01
R8669:Ift122	UTSW	6	115923291	missense	probably damaging	0.98
R8867:Ift122	UTSW	6	115880671	missense	probably damaging	1.00
R8887:Ift122	UTSW	6	115891919	missense	probably benign	0.00
R8947:Ift122	UTSW	6	115924407	missense	probably benign
R8978:Ift122	UTSW	6	115925808	missense	possibly damaging	0.78
R9149:Ift122	UTSW	6	115890531	missense	probably damaging	1.00
R9571:Ift122	UTSW	6	115880667	missense	possibly damaging	0.50
R9573:Ift122	UTSW	6	115880685	missense	probably benign
R9677:Ift122	UTSW	6	115920396	missense	probably benign	0.16
Z1176:Ift122	UTSW	6	115915994	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGCAGTCTCGTGTAAGCC -3'
(R):5'- GTCCTACTTACAGGCAAACTTGAAAG -3'

Sequencing Primer
(F):5'- AGTCTCGTGTAAGCCCTGCAG -3'
(R):5'- ACAGGCCAGATTGTGCCATTG -3'

Posted On

2017-10-10