Incidental Mutation 'R6141:Ift122'
ID 488576
Institutional Source Beutler Lab
Gene Symbol Ift122
Ensembl Gene ENSMUSG00000030323
Gene Name intraflagellar transport 122
Synonyms C86139, sopb, Wdr10
MMRRC Submission 044288-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6141 (G1)
Quality Score 101.008
Status Validated
Chromosome 6
Chromosomal Location 115853470-115926699 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 115916011 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 919 (W919R)
Ref Sequence ENSEMBL: ENSMUSP00000108545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038234] [ENSMUST00000112923] [ENSMUST00000112925] [ENSMUST00000141305]
AlphaFold Q6NWV3
Predicted Effect probably damaging
Transcript: ENSMUST00000038234
AA Change: W860R

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045468
Gene: ENSMUSG00000030323
AA Change: W860R

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
WD40 162 208 2.29e1 SMART
WD40 210 249 1.91e1 SMART
WD40 251 290 3.45e-3 SMART
WD40 448 483 1.43e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112923
AA Change: W919R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108545
Gene: ENSMUSG00000030323
AA Change: W919R

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
Blast:WD40 163 267 3e-46 BLAST
WD40 269 308 1.91e1 SMART
WD40 310 349 3.45e-3 SMART
WD40 507 542 1.43e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112925
AA Change: W860R

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108547
Gene: ENSMUSG00000030323
AA Change: W860R

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
WD40 162 208 2.29e1 SMART
WD40 210 249 1.91e1 SMART
WD40 251 290 3.45e-3 SMART
WD40 448 483 1.43e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124283
Predicted Effect probably benign
Transcript: ENSMUST00000141305
SMART Domains Protein: ENSMUSP00000138535
Gene: ENSMUSG00000030323

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
low complexity region 124 134 N/A INTRINSIC
low complexity region 162 176 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155565
Meta Mutation Damage Score 0.6625 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This cytoplasmic protein contains seven WD repeats and an AF-2 domain which function by recruiting coregulatory molecules and in transcriptional activation. Mutations in this gene cause cranioectodermal dysplasia-1. A related pseudogene is located on chromosome 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for a null mutation display embryonic lethality during organogenesis with exencephaly, a ventralized caudal neural tube, preaxial polydactyly, abnormal cilia, and left-right patterning defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik A T 7: 42,448,059 C4S probably damaging Het
Abhd5 A T 9: 122,377,933 T95S probably benign Het
Ambra1 A T 2: 91,875,754 N795Y probably damaging Het
Brca2 A G 5: 150,540,637 N1289D possibly damaging Het
Cavin2 T C 1: 51,300,938 L258P probably damaging Het
Ccdc110 A G 8: 45,941,770 T233A possibly damaging Het
Ccdc14 T A 16: 34,706,562 I279N probably damaging Het
Cntn5 A T 9: 10,144,157 L169Q probably benign Het
Dbf4 T C 5: 8,408,545 S157G possibly damaging Het
Defb22 A T 2: 152,485,802 N154K unknown Het
Eepd1 T A 9: 25,482,984 D181E probably benign Het
Etfa T C 9: 55,464,819 H286R probably damaging Het
Gm44419 T A 6: 65,150,956 noncoding transcript Het
Gpatch4 C T 3: 88,054,740 R155* probably null Het
Grik1 T G 16: 87,896,872 R862S probably benign Het
Hectd1 A C 12: 51,746,092 probably null Het
Iqgap2 A T 13: 95,721,686 probably null Het
Kcnq4 A T 4: 120,715,869 I245N probably damaging Het
Map3k3 G T 11: 106,097,048 R21L probably benign Het
Mllt10 T C 2: 18,210,793 V1063A probably damaging Het
Msr1 A T 8: 39,631,319 V65E probably damaging Het
Myom2 A T 8: 15,063,903 D17V probably damaging Het
Naaladl1 T A 19: 6,109,755 probably null Het
Naip6 T C 13: 100,308,233 Y239C possibly damaging Het
Nckap1 C A 2: 80,530,207 D533Y probably damaging Het
Ndufs2 T C 1: 171,236,616 E375G probably damaging Het
Nsd1 T C 13: 55,291,284 V1605A probably damaging Het
Olfr1290 A G 2: 111,490,119 I13T probably benign Het
Olfr1468-ps1 A T 19: 13,375,283 Y107F probably benign Het
Olfr199 T A 16: 59,216,553 H20L probably benign Het
Olfr629 C A 7: 103,740,787 R151L probably damaging Het
Olfr872 T A 9: 20,260,458 M206K probably benign Het
Pcp2 G A 8: 3,623,543 probably null Het
Pdgfra A G 5: 75,173,396 S377G probably damaging Het
Pqlc2 A G 4: 139,300,245 V262A probably benign Het
Reep5 A T 18: 34,372,458 Y53* probably null Het
Ric1 T C 19: 29,595,442 S761P probably damaging Het
Satb1 T C 17: 51,775,376 T417A possibly damaging Het
Slc1a7 T A 4: 108,002,182 M156K possibly damaging Het
Slc4a10 A G 2: 62,211,445 E123G probably damaging Het
Snupn C A 9: 56,982,824 Q310K possibly damaging Het
Stard13 A T 5: 151,042,242 V916E probably damaging Het
Tlr1 T C 5: 64,925,213 R674G possibly damaging Het
Tnfsf11 A G 14: 78,307,859 Y11H probably damaging Het
Tnr T A 1: 159,887,122 V857E probably benign Het
Tubgcp5 A G 7: 55,806,778 I373V probably benign Het
Ush2a A T 1: 188,357,963 R414S possibly damaging Het
Vmn2r100 T C 17: 19,522,314 S317P probably benign Het
Wdr49 A T 3: 75,323,682 F558I probably benign Het
Zfyve16 A G 13: 92,511,597 I983T probably benign Het
Other mutations in Ift122
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Ift122 APN 6 115917057 missense probably benign 0.10
IGL00783:Ift122 APN 6 115905902 missense probably benign
IGL00784:Ift122 APN 6 115905902 missense probably benign
IGL00799:Ift122 APN 6 115877536 missense probably damaging 1.00
IGL00908:Ift122 APN 6 115913909 missense probably benign 0.00
IGL01012:Ift122 APN 6 115899491 missense probably damaging 0.99
IGL01444:Ift122 APN 6 115884379 missense probably benign 0.08
IGL01451:Ift122 APN 6 115912604 critical splice donor site probably null
IGL01940:Ift122 APN 6 115887371 splice site probably benign
IGL02089:Ift122 APN 6 115925437 missense probably benign 0.00
IGL02331:Ift122 APN 6 115887324 missense probably damaging 1.00
IGL02929:Ift122 APN 6 115902877 missense probably damaging 1.00
IGL03169:Ift122 APN 6 115905961 splice site probably benign
PIT1430001:Ift122 UTSW 6 115925744 splice site probably benign
R0158:Ift122 UTSW 6 115924484 splice site probably benign
R0496:Ift122 UTSW 6 115905902 missense probably benign
R1065:Ift122 UTSW 6 115875325 splice site probably null
R1670:Ift122 UTSW 6 115923883 missense probably benign 0.05
R1861:Ift122 UTSW 6 115891928 missense probably damaging 1.00
R1889:Ift122 UTSW 6 115894421 critical splice donor site probably null
R1990:Ift122 UTSW 6 115924367 missense probably damaging 1.00
R2362:Ift122 UTSW 6 115884350 missense probably damaging 0.99
R2385:Ift122 UTSW 6 115912522 missense probably benign 0.21
R3734:Ift122 UTSW 6 115925501 splice site probably benign
R3800:Ift122 UTSW 6 115925906 missense probably benign 0.03
R3981:Ift122 UTSW 6 115913921 missense probably benign 0.02
R4289:Ift122 UTSW 6 115923891 missense probably damaging 1.00
R4545:Ift122 UTSW 6 115890588 missense probably damaging 1.00
R4546:Ift122 UTSW 6 115890588 missense probably damaging 1.00
R4641:Ift122 UTSW 6 115888765 nonsense probably null
R4815:Ift122 UTSW 6 115881556 missense possibly damaging 0.95
R4854:Ift122 UTSW 6 115862746 missense possibly damaging 0.61
R4928:Ift122 UTSW 6 115915858 utr 3 prime probably benign
R5021:Ift122 UTSW 6 115864372 missense probably benign 0.41
R5121:Ift122 UTSW 6 115912534 missense probably benign 0.04
R5200:Ift122 UTSW 6 115920379 missense probably damaging 0.99
R5549:Ift122 UTSW 6 115892022 missense probably damaging 1.00
R6111:Ift122 UTSW 6 115875286 missense probably damaging 1.00
R6766:Ift122 UTSW 6 115926243 missense probably benign 0.15
R7379:Ift122 UTSW 6 115926302 missense probably benign
R7402:Ift122 UTSW 6 115894322 missense probably benign 0.00
R7436:Ift122 UTSW 6 115926302 missense probably benign
R7437:Ift122 UTSW 6 115926302 missense probably benign
R7438:Ift122 UTSW 6 115926302 missense probably benign
R7517:Ift122 UTSW 6 115890582 missense probably benign 0.37
R7978:Ift122 UTSW 6 115920352 missense probably benign 0.37
R8492:Ift122 UTSW 6 115887005 missense probably benign 0.02
R8493:Ift122 UTSW 6 115910331 missense probably benign 0.01
R8669:Ift122 UTSW 6 115923291 missense probably damaging 0.98
R8867:Ift122 UTSW 6 115880671 missense probably damaging 1.00
R8887:Ift122 UTSW 6 115891919 missense probably benign 0.00
R8947:Ift122 UTSW 6 115924407 missense probably benign
R8978:Ift122 UTSW 6 115925808 missense possibly damaging 0.78
R9149:Ift122 UTSW 6 115890531 missense probably damaging 1.00
Z1176:Ift122 UTSW 6 115915994 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCAGTCTCGTGTAAGCC -3'
(R):5'- GTCCTACTTACAGGCAAACTTGAAAG -3'

Sequencing Primer
(F):5'- AGTCTCGTGTAAGCCCTGCAG -3'
(R):5'- ACAGGCCAGATTGTGCCATTG -3'
Posted On 2017-10-10