Incidental Mutation 'R6141:Olfr199'
ID488596
Institutional Source Beutler Lab
Gene Symbol Olfr199
Ensembl Gene ENSMUSG00000074996
Gene Nameolfactory receptor 199
SynonymsGA_x54KRFPKG5P-55430495-55429569, MOR182-14
MMRRC Submission 044288-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6141 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location59214134-59219767 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59216553 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 20 (H20L)
Ref Sequence ENSEMBL: ENSMUSP00000150643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099657] [ENSMUST00000214186]
Predicted Effect probably benign
Transcript: ENSMUST00000099657
AA Change: H20L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097249
Gene: ENSMUSG00000074996
AA Change: H20L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.7e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.6e-6 PFAM
Pfam:7tm_1 41 290 4.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214186
AA Change: H20L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik A T 7: 42,448,059 C4S probably damaging Het
Abhd5 A T 9: 122,377,933 T95S probably benign Het
Ambra1 A T 2: 91,875,754 N795Y probably damaging Het
Brca2 A G 5: 150,540,637 N1289D possibly damaging Het
Cavin2 T C 1: 51,300,938 L258P probably damaging Het
Ccdc110 A G 8: 45,941,770 T233A possibly damaging Het
Ccdc14 T A 16: 34,706,562 I279N probably damaging Het
Cntn5 A T 9: 10,144,157 L169Q probably benign Het
Dbf4 T C 5: 8,408,545 S157G possibly damaging Het
Defb22 A T 2: 152,485,802 N154K unknown Het
Eepd1 T A 9: 25,482,984 D181E probably benign Het
Etfa T C 9: 55,464,819 H286R probably damaging Het
Gm44419 T A 6: 65,150,956 noncoding transcript Het
Gpatch4 C T 3: 88,054,740 R155* probably null Het
Grik1 T G 16: 87,896,872 R862S probably benign Het
Hectd1 A C 12: 51,746,092 probably null Het
Ift122 T C 6: 115,916,011 W919R probably damaging Het
Iqgap2 A T 13: 95,721,686 probably null Het
Kcnq4 A T 4: 120,715,869 I245N probably damaging Het
Map3k3 G T 11: 106,097,048 R21L probably benign Het
Mllt10 T C 2: 18,210,793 V1063A probably damaging Het
Msr1 A T 8: 39,631,319 V65E probably damaging Het
Myom2 A T 8: 15,063,903 D17V probably damaging Het
Naaladl1 T A 19: 6,109,755 probably null Het
Naip6 T C 13: 100,308,233 Y239C possibly damaging Het
Nckap1 C A 2: 80,530,207 D533Y probably damaging Het
Ndufs2 T C 1: 171,236,616 E375G probably damaging Het
Nsd1 T C 13: 55,291,284 V1605A probably damaging Het
Olfr1290 A G 2: 111,490,119 I13T probably benign Het
Olfr1468-ps1 A T 19: 13,375,283 Y107F probably benign Het
Olfr629 C A 7: 103,740,787 R151L probably damaging Het
Olfr872 T A 9: 20,260,458 M206K probably benign Het
Pcp2 G A 8: 3,623,543 probably null Het
Pdgfra A G 5: 75,173,396 S377G probably damaging Het
Pqlc2 A G 4: 139,300,245 V262A probably benign Het
Reep5 A T 18: 34,372,458 Y53* probably null Het
Ric1 T C 19: 29,595,442 S761P probably damaging Het
Satb1 T C 17: 51,775,376 T417A possibly damaging Het
Slc1a7 T A 4: 108,002,182 M156K possibly damaging Het
Slc4a10 A G 2: 62,211,445 E123G probably damaging Het
Snupn C A 9: 56,982,824 Q310K possibly damaging Het
Stard13 A T 5: 151,042,242 V916E probably damaging Het
Tlr1 T C 5: 64,925,213 R674G possibly damaging Het
Tnfsf11 A G 14: 78,307,859 Y11H probably damaging Het
Tnr T A 1: 159,887,122 V857E probably benign Het
Tubgcp5 A G 7: 55,806,778 I373V probably benign Het
Ush2a A T 1: 188,357,963 R414S possibly damaging Het
Vmn2r100 T C 17: 19,522,314 S317P probably benign Het
Wdr49 A T 3: 75,323,682 F558I probably benign Het
Zfyve16 A G 13: 92,511,597 I983T probably benign Het
Other mutations in Olfr199
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Olfr199 APN 16 59216496 missense probably damaging 0.97
IGL00972:Olfr199 APN 16 59216466 missense probably damaging 1.00
IGL01734:Olfr199 APN 16 59216429 missense probably benign 0.12
IGL01876:Olfr199 APN 16 59216019 missense possibly damaging 0.89
IGL02017:Olfr199 APN 16 59215947 missense probably damaging 1.00
IGL02871:Olfr199 APN 16 59216374 nonsense probably null
IGL03153:Olfr199 APN 16 59216203 missense probably benign 0.35
R0702:Olfr199 UTSW 16 59215699 missense probably benign
R0825:Olfr199 UTSW 16 59216450 missense possibly damaging 0.70
R1522:Olfr199 UTSW 16 59215984 missense probably damaging 1.00
R1769:Olfr199 UTSW 16 59215981 missense probably benign 0.01
R2144:Olfr199 UTSW 16 59216026 missense probably benign 0.00
R3956:Olfr199 UTSW 16 59216065 nonsense probably null
R4783:Olfr199 UTSW 16 59215859 missense probably damaging 0.98
R5534:Olfr199 UTSW 16 59216040 missense probably benign 0.39
R6031:Olfr199 UTSW 16 59215933 missense probably benign 0.00
R6031:Olfr199 UTSW 16 59215933 missense probably benign 0.00
R6445:Olfr199 UTSW 16 59216109 missense probably damaging 1.00
R6459:Olfr199 UTSW 16 59216020 missense probably benign 0.44
R6568:Olfr199 UTSW 16 59216278 missense probably benign 0.36
R7378:Olfr199 UTSW 16 59215920 missense probably benign 0.00
R7438:Olfr199 UTSW 16 59216398 missense probably benign 0.10
R8157:Olfr199 UTSW 16 59215989 missense probably benign
R8258:Olfr199 UTSW 16 59216095 missense probably benign 0.00
R8259:Olfr199 UTSW 16 59216095 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCAGGGTTATCTCATGATTTG -3'
(R):5'- GTCTGGCATTAGAAACATCCATTTGG -3'

Sequencing Primer
(F):5'- TGAGAAGCATTTTGGGAGTCAC -3'
(R):5'- CCATTTGGGATAGTGACAATGATAAC -3'
Posted On2017-10-10