Incidental Mutation 'R6142:Crocc2'
ID488604
Institutional Source Beutler Lab
Gene Symbol Crocc2
Ensembl Gene ENSMUSG00000084989
Gene Nameciliary rootlet coiled-coil, rootletin family member 2
SynonymsLOC381284, E030010N08Rik
MMRRC Submission 044289-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R6142 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location93168725-93231072 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 93190479 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Glutamic Acid at position 375 (Q375E)
Ref Sequence ENSEMBL: ENSMUSP00000120588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138595]
Predicted Effect possibly damaging
Transcript: ENSMUST00000138595
AA Change: Q375E

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120588
Gene: ENSMUSG00000084989
AA Change: Q375E

DomainStartEndE-ValueType
low complexity region 67 82 N/A INTRINSIC
Pfam:Rootletin 89 260 5.1e-24 PFAM
coiled coil region 281 346 N/A INTRINSIC
internal_repeat_1 381 424 9.68e-9 PROSPERO
internal_repeat_3 389 414 5.46e-6 PROSPERO
internal_repeat_4 398 425 1.1e-5 PROSPERO
coiled coil region 426 627 N/A INTRINSIC
coiled coil region 655 1247 N/A INTRINSIC
internal_repeat_2 1252 1280 6.61e-7 PROSPERO
internal_repeat_4 1341 1374 1.1e-5 PROSPERO
internal_repeat_1 1347 1384 9.68e-9 PROSPERO
coiled coil region 1403 1512 N/A INTRINSIC
coiled coil region 1539 1582 N/A INTRINSIC
low complexity region 1590 1604 N/A INTRINSIC
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.2%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 T C 15: 98,598,422 M579V probably benign Het
Agtr1b T C 3: 20,316,394 D16G probably benign Het
Akap12 C A 10: 4,313,740 probably null Het
Alpk2 T C 18: 65,305,385 E979G possibly damaging Het
Arfgap3 T C 15: 83,350,127 D8G probably damaging Het
AW551984 G T 9: 39,597,114 L369I probably benign Het
Bmp8b A T 4: 123,115,250 H207L probably benign Het
Cc2d2a G T 5: 43,703,198 V490F probably damaging Het
Cnot6l C T 5: 96,082,978 V377I probably benign Het
Col25a1 T A 3: 130,583,329 probably benign Het
Ganc T C 2: 120,430,737 probably null Het
Gm28168 C A 1: 117,947,948 D102E probably benign Het
Gm8212 T C 14: 44,201,227 probably null Het
Gria2 T C 3: 80,801,717 T53A probably benign Het
Hipk4 G A 7: 27,529,165 V347M probably damaging Het
Hmgxb3 T C 18: 61,136,237 E991G probably benign Het
Hyal1 G A 9: 107,579,374 R420H probably benign Het
Il5 G A 11: 53,720,978 probably null Het
Kcnh7 T C 2: 62,739,360 I731V possibly damaging Het
Lamb2 A T 9: 108,485,618 K759* probably null Het
Lnpep A G 17: 17,566,681 probably null Het
Lrch1 T C 14: 74,947,500 E54G probably damaging Het
Msl3l2 A G 10: 56,115,365 D62G possibly damaging Het
Mslnl T C 17: 25,744,557 L339P probably damaging Het
Nfe2l2 T C 2: 75,679,417 I20V probably damaging Het
Pgm5 A C 19: 24,824,408 I152S probably damaging Het
Plcg2 C A 8: 117,585,271 T434K probably benign Het
Prrc2c T C 1: 162,710,387 E558G unknown Het
Ranbp3 T C 17: 56,686,018 V12A probably benign Het
Rgsl1 A G 1: 153,812,238 V635A probably benign Het
Rpap2 T C 5: 107,598,298 V14A probably benign Het
Rxrg G T 1: 167,632,622 A341S possibly damaging Het
Sbf2 A G 7: 110,348,975 S1177P probably damaging Het
Sema6a T C 18: 47,281,199 T498A probably benign Het
Slc13a4 G A 6: 35,301,783 A57V probably damaging Het
Slc6a3 A T 13: 73,544,783 D174V probably benign Het
Spg20 T G 3: 55,117,248 V88G probably damaging Het
Tanc1 A T 2: 59,833,222 R1108* probably null Het
Tas2r140 C T 6: 133,055,735 G20E probably damaging Het
Tdrd6 A G 17: 43,629,482 V225A probably benign Het
Tmem168 C A 6: 13,591,369 A99S probably benign Het
Tnk2 T A 16: 32,670,099 D252E probably damaging Het
Tpsg1 A T 17: 25,372,486 H20L probably benign Het
Tram1l1 T C 3: 124,321,443 F84S probably damaging Het
Vmn2r12 T A 5: 109,092,897 I117L probably benign Het
Zfp148 T C 16: 33,495,459 L219S possibly damaging Het
Zfp40 C A 17: 23,176,337 E425D probably benign Het
Zfp773 T C 7: 7,132,482 T372A probably benign Het
Other mutations in Crocc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Crocc2 APN 1 93217044 nonsense probably null
R0396:Crocc2 UTSW 1 93224214 splice site probably benign
R1382:Crocc2 UTSW 1 93217093 critical splice donor site probably null
R4608:Crocc2 UTSW 1 93168794 missense possibly damaging 0.95
R4609:Crocc2 UTSW 1 93168794 missense possibly damaging 0.95
R4619:Crocc2 UTSW 1 93213650 missense probably benign
R4646:Crocc2 UTSW 1 93168794 missense possibly damaging 0.95
R4647:Crocc2 UTSW 1 93168794 missense possibly damaging 0.95
R4648:Crocc2 UTSW 1 93168794 missense possibly damaging 0.95
R4767:Crocc2 UTSW 1 93202856 missense possibly damaging 0.72
R4811:Crocc2 UTSW 1 93205896 missense probably damaging 0.99
R5046:Crocc2 UTSW 1 93205902 missense probably damaging 0.96
R5389:Crocc2 UTSW 1 93215641 missense probably benign 0.03
R5632:Crocc2 UTSW 1 93217853 missense probably damaging 0.98
R5887:Crocc2 UTSW 1 93194116 missense possibly damaging 0.47
R6128:Crocc2 UTSW 1 93194401 missense probably benign 0.28
R6258:Crocc2 UTSW 1 93213638 missense possibly damaging 0.57
R6260:Crocc2 UTSW 1 93213638 missense possibly damaging 0.57
R6288:Crocc2 UTSW 1 93194505 missense probably benign 0.07
R6312:Crocc2 UTSW 1 93215710 nonsense probably null
R6335:Crocc2 UTSW 1 93202838 missense probably benign 0.02
R6339:Crocc2 UTSW 1 93214032 missense probably benign 0.23
R6371:Crocc2 UTSW 1 93215631 missense probably benign 0.10
R6439:Crocc2 UTSW 1 93183404 missense possibly damaging 0.81
R6442:Crocc2 UTSW 1 93185053 missense probably benign 0.38
R6545:Crocc2 UTSW 1 93212937 missense probably benign 0.45
R6619:Crocc2 UTSW 1 93190501 missense probably benign 0.09
R6898:Crocc2 UTSW 1 93215582 missense probably benign 0.06
R7170:Crocc2 UTSW 1 93193982 missense possibly damaging 0.95
R7378:Crocc2 UTSW 1 93194087 missense probably damaging 0.98
R7395:Crocc2 UTSW 1 93216107 nonsense probably null
R7461:Crocc2 UTSW 1 93194589 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- ATGTCCTGGCCAGCATCAAG -3'
(R):5'- AAGGCTCTAGACACCTGAGG -3'

Sequencing Primer
(F):5'- CAGCATCAAGGAGGTATGGCC -3'
(R):5'- CTTTCAATGGCTGCCTGCACAG -3'
Posted On2017-10-10