Incidental Mutation 'R6142:Rxrg'
ID488608
Institutional Source Beutler Lab
Gene Symbol Rxrg
Ensembl Gene ENSMUSG00000015843
Gene Nameretinoid X receptor gamma
SynonymsNr2b3
MMRRC Submission 044289-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.649) question?
Stock #R6142 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location167598384-167639623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 167632622 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 341 (A341S)
Ref Sequence ENSEMBL: ENSMUSP00000107017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015987] [ENSMUST00000111380] [ENSMUST00000111384] [ENSMUST00000111386]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015987
AA Change: A341S

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000015987
Gene: ENSMUSG00000015843
AA Change: A341S

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 25 134 1.2e-39 PFAM
ZnF_C4 136 207 6.92e-39 SMART
HOLI 271 430 2.7e-50 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111380
AA Change: A218S

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107011
Gene: ENSMUSG00000015843
AA Change: A218S

DomainStartEndE-ValueType
ZnF_C4 13 84 6.92e-39 SMART
HOLI 148 307 2.7e-50 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111384
AA Change: A341S

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107015
Gene: ENSMUSG00000015843
AA Change: A341S

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 24 134 3.4e-35 PFAM
ZnF_C4 136 207 6.92e-39 SMART
HOLI 271 430 2.7e-50 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111386
AA Change: A341S

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107017
Gene: ENSMUSG00000015843
AA Change: A341S

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 24 134 3.4e-35 PFAM
ZnF_C4 136 207 6.92e-39 SMART
HOLI 271 430 2.7e-50 SMART
Meta Mutation Damage Score 0.2024 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the retinoid X receptor (RXR) family of nuclear receptors which are involved in mediating the antiproliferative effects of retinoic acid (RA). This receptor forms dimers with the retinoic acid, thyroid hormone, and vitamin D receptors, increasing both DNA binding and transcriptional function on their respective response elements. This gene is expressed at significantly lower levels in non-small cell lung cancer cells. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jun 2010]
PHENOTYPE: Targeted disruption of exon 2 causes a 25% reduction of neurons in the striatum and may lead to premature death and altered responses to the administration of dopamine antagonists on some genetic backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 T C 15: 98,598,422 M579V probably benign Het
Agtr1b T C 3: 20,316,394 D16G probably benign Het
Akap12 C A 10: 4,313,740 probably null Het
Alpk2 T C 18: 65,305,385 E979G possibly damaging Het
Arfgap3 T C 15: 83,350,127 D8G probably damaging Het
AW551984 G T 9: 39,597,114 L369I probably benign Het
Bmp8b A T 4: 123,115,250 H207L probably benign Het
Cc2d2a G T 5: 43,703,198 V490F probably damaging Het
Cnot6l C T 5: 96,082,978 V377I probably benign Het
Col25a1 T A 3: 130,583,329 probably benign Het
Crocc2 C G 1: 93,190,479 Q375E possibly damaging Het
Ganc T C 2: 120,430,737 probably null Het
Gm28168 C A 1: 117,947,948 D102E probably benign Het
Gm8212 T C 14: 44,201,227 probably null Het
Gria2 T C 3: 80,801,717 T53A probably benign Het
Hipk4 G A 7: 27,529,165 V347M probably damaging Het
Hmgxb3 T C 18: 61,136,237 E991G probably benign Het
Hyal1 G A 9: 107,579,374 R420H probably benign Het
Il5 G A 11: 53,720,978 probably null Het
Kcnh7 T C 2: 62,739,360 I731V possibly damaging Het
Lamb2 A T 9: 108,485,618 K759* probably null Het
Lnpep A G 17: 17,566,681 probably null Het
Lrch1 T C 14: 74,947,500 E54G probably damaging Het
Msl3l2 A G 10: 56,115,365 D62G possibly damaging Het
Mslnl T C 17: 25,744,557 L339P probably damaging Het
Nfe2l2 T C 2: 75,679,417 I20V probably damaging Het
Pgm5 A C 19: 24,824,408 I152S probably damaging Het
Plcg2 C A 8: 117,585,271 T434K probably benign Het
Prrc2c T C 1: 162,710,387 E558G unknown Het
Ranbp3 T C 17: 56,686,018 V12A probably benign Het
Rgsl1 A G 1: 153,812,238 V635A probably benign Het
Rpap2 T C 5: 107,598,298 V14A probably benign Het
Sbf2 A G 7: 110,348,975 S1177P probably damaging Het
Sema6a T C 18: 47,281,199 T498A probably benign Het
Slc13a4 G A 6: 35,301,783 A57V probably damaging Het
Slc6a3 A T 13: 73,544,783 D174V probably benign Het
Spg20 T G 3: 55,117,248 V88G probably damaging Het
Tanc1 A T 2: 59,833,222 R1108* probably null Het
Tas2r140 C T 6: 133,055,735 G20E probably damaging Het
Tdrd6 A G 17: 43,629,482 V225A probably benign Het
Tmem168 C A 6: 13,591,369 A99S probably benign Het
Tnk2 T A 16: 32,670,099 D252E probably damaging Het
Tpsg1 A T 17: 25,372,486 H20L probably benign Het
Tram1l1 T C 3: 124,321,443 F84S probably damaging Het
Vmn2r12 T A 5: 109,092,897 I117L probably benign Het
Zfp148 T C 16: 33,495,459 L219S possibly damaging Het
Zfp40 C A 17: 23,176,337 E425D probably benign Het
Zfp773 T C 7: 7,132,482 T372A probably benign Het
Other mutations in Rxrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Rxrg APN 1 167627288 splice site probably benign
IGL01767:Rxrg APN 1 167627315 missense probably damaging 1.00
IGL02126:Rxrg APN 1 167634460 missense probably damaging 0.98
IGL03144:Rxrg APN 1 167598758 missense possibly damaging 0.53
R0482:Rxrg UTSW 1 167631037 missense possibly damaging 0.94
R0548:Rxrg UTSW 1 167631219 splice site probably benign
R0734:Rxrg UTSW 1 167627444 missense probably damaging 1.00
R1294:Rxrg UTSW 1 167613901 missense probably benign
R1843:Rxrg UTSW 1 167598752 start codon destroyed probably benign 0.02
R2093:Rxrg UTSW 1 167627324 missense probably damaging 1.00
R2972:Rxrg UTSW 1 167639146 missense probably damaging 1.00
R2974:Rxrg UTSW 1 167639146 missense probably damaging 1.00
R3177:Rxrg UTSW 1 167635700 missense possibly damaging 0.64
R3277:Rxrg UTSW 1 167635700 missense possibly damaging 0.64
R4484:Rxrg UTSW 1 167625027 missense probably benign 0.03
R4721:Rxrg UTSW 1 167625052 missense probably damaging 1.00
R5267:Rxrg UTSW 1 167635766 missense probably damaging 0.98
R5323:Rxrg UTSW 1 167625004 missense probably benign
R5858:Rxrg UTSW 1 167627356 missense probably damaging 1.00
R5921:Rxrg UTSW 1 167639239 missense possibly damaging 0.55
R6370:Rxrg UTSW 1 167634437 missense probably damaging 1.00
R6595:Rxrg UTSW 1 167627336 missense probably damaging 1.00
R6702:Rxrg UTSW 1 167613805 missense probably benign
R7133:Rxrg UTSW 1 167631109 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAACCTTTCGGGGATTTCCAC -3'
(R):5'- ATAGTCATGTGCACCTGTTTGG -3'

Sequencing Primer
(F):5'- CATTACGTGGGATGATGCGCC -3'
(R):5'- ACCTGTTTGGGCTGCCTACTG -3'
Posted On2017-10-10