Incidental Mutation 'R6142:Bmp8b'
ID488616
Institutional Source Beutler Lab
Gene Symbol Bmp8b
Ensembl Gene ENSMUSG00000002384
Gene Namebone morphogenetic protein 8b
SynonymsOp3
MMRRC Submission 044289-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R6142 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location123105165-123132099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123115250 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 207 (H207L)
Ref Sequence ENSEMBL: ENSMUSP00000002457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002457] [ENSMUST00000102648]
Predicted Effect probably benign
Transcript: ENSMUST00000002457
AA Change: H207L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002457
Gene: ENSMUSG00000002384
AA Change: H207L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:TGFb_propeptide 26 248 2.7e-62 PFAM
TGFB 298 399 2.83e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102648
SMART Domains Protein: ENSMUSP00000099708
Gene: ENSMUSG00000076438

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
CoA_trans 43 272 2.02e-79 SMART
CoA_trans 301 499 5.07e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194481
Meta Mutation Damage Score 0.1172 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The encoded protein may play a role in the generation of primordial germ cells, and has been shown to stimulate thermogenesis in brown adipose tissue. Male mice lacking a functional copy of this gene exhibit variable degrees of germ-cell deficiency. Homozygous knockout mice of both sexes exhibit impaired thermogenesis and reduced metabolic rate, resulting in weight gain. This gene may have arose from a gene duplication event and its gene duplicate is also present on chromosome 4. [provided by RefSeq, Jul 2016]
PHENOTYPE: Incidence of lethality among homozygous null mutants is variable depending on genetic background and due to allantoic and embryonic abnormalities. Heterozygous and surviving homozygous males exhibit varying degrees of germ cell deficiency and infertility, also background dependent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 T C 15: 98,598,422 M579V probably benign Het
Agtr1b T C 3: 20,316,394 D16G probably benign Het
Akap12 C A 10: 4,313,740 probably null Het
Alpk2 T C 18: 65,305,385 E979G possibly damaging Het
Arfgap3 T C 15: 83,350,127 D8G probably damaging Het
AW551984 G T 9: 39,597,114 L369I probably benign Het
Cc2d2a G T 5: 43,703,198 V490F probably damaging Het
Cnot6l C T 5: 96,082,978 V377I probably benign Het
Col25a1 T A 3: 130,583,329 probably benign Het
Crocc2 C G 1: 93,190,479 Q375E possibly damaging Het
Ganc T C 2: 120,430,737 probably null Het
Gm28168 C A 1: 117,947,948 D102E probably benign Het
Gm8212 T C 14: 44,201,227 probably null Het
Gria2 T C 3: 80,801,717 T53A probably benign Het
Hipk4 G A 7: 27,529,165 V347M probably damaging Het
Hmgxb3 T C 18: 61,136,237 E991G probably benign Het
Hyal1 G A 9: 107,579,374 R420H probably benign Het
Il5 G A 11: 53,720,978 probably null Het
Kcnh7 T C 2: 62,739,360 I731V possibly damaging Het
Lamb2 A T 9: 108,485,618 K759* probably null Het
Lnpep A G 17: 17,566,681 probably null Het
Lrch1 T C 14: 74,947,500 E54G probably damaging Het
Msl3l2 A G 10: 56,115,365 D62G possibly damaging Het
Mslnl T C 17: 25,744,557 L339P probably damaging Het
Nfe2l2 T C 2: 75,679,417 I20V probably damaging Het
Pgm5 A C 19: 24,824,408 I152S probably damaging Het
Plcg2 C A 8: 117,585,271 T434K probably benign Het
Prrc2c T C 1: 162,710,387 E558G unknown Het
Ranbp3 T C 17: 56,686,018 V12A probably benign Het
Rgsl1 A G 1: 153,812,238 V635A probably benign Het
Rpap2 T C 5: 107,598,298 V14A probably benign Het
Rxrg G T 1: 167,632,622 A341S possibly damaging Het
Sbf2 A G 7: 110,348,975 S1177P probably damaging Het
Sema6a T C 18: 47,281,199 T498A probably benign Het
Slc13a4 G A 6: 35,301,783 A57V probably damaging Het
Slc6a3 A T 13: 73,544,783 D174V probably benign Het
Spg20 T G 3: 55,117,248 V88G probably damaging Het
Tanc1 A T 2: 59,833,222 R1108* probably null Het
Tas2r140 C T 6: 133,055,735 G20E probably damaging Het
Tdrd6 A G 17: 43,629,482 V225A probably benign Het
Tmem168 C A 6: 13,591,369 A99S probably benign Het
Tnk2 T A 16: 32,670,099 D252E probably damaging Het
Tpsg1 A T 17: 25,372,486 H20L probably benign Het
Tram1l1 T C 3: 124,321,443 F84S probably damaging Het
Vmn2r12 T A 5: 109,092,897 I117L probably benign Het
Zfp148 T C 16: 33,495,459 L219S possibly damaging Het
Zfp40 C A 17: 23,176,337 E425D probably benign Het
Zfp773 T C 7: 7,132,482 T372A probably benign Het
Other mutations in Bmp8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Bmp8b APN 4 123124409 missense probably benign 0.19
R0334:Bmp8b UTSW 4 123114760 splice site probably null
R0441:Bmp8b UTSW 4 123124515 missense probably damaging 1.00
R0472:Bmp8b UTSW 4 123121899 missense probably benign 0.06
R0609:Bmp8b UTSW 4 123121899 missense probably benign 0.06
R0732:Bmp8b UTSW 4 123105406 missense unknown
R1221:Bmp8b UTSW 4 123114711 missense probably damaging 1.00
R2200:Bmp8b UTSW 4 123123022 missense possibly damaging 0.81
R3847:Bmp8b UTSW 4 123116168 unclassified probably benign
R4003:Bmp8b UTSW 4 123121878 unclassified probably benign
R4777:Bmp8b UTSW 4 123122000 missense possibly damaging 0.61
R4834:Bmp8b UTSW 4 123123050 missense probably damaging 1.00
R4911:Bmp8b UTSW 4 123115237 missense probably damaging 1.00
R5207:Bmp8b UTSW 4 123115921 unclassified probably benign
R5509:Bmp8b UTSW 4 123114576 missense possibly damaging 0.78
R5549:Bmp8b UTSW 4 123124485 missense probably damaging 1.00
R5795:Bmp8b UTSW 4 123121968 missense possibly damaging 0.59
R7549:Bmp8b UTSW 4 123105655 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- AAGAGGCTCTGAGAGTGGTC -3'
(R):5'- TGTCCAGGACCTCACCATTCTG -3'

Sequencing Primer
(F):5'- TCTGAGAGTGGTCCCCAG -3'
(R):5'- TTCTGCCCAAGTCCTCAATAAAGG -3'
Posted On2017-10-10